Anthophora pubescens

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records767

Data sources7

Biological traits0

DNA specimens23

eDNA detections20

Sources7 archives

Databases and archives Anthophora pubescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility767 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF767 records

Environmental DNA1 datasets · 6 countries20 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anthophora pubescens ist eine Biene aus der Familie der Apidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora pubescens has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections20

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

37Gmostly conserved

64Cvariable

88Gmostly conserved

89Gmostly conserved

94Amostly conserved

163Tmostly conserved

184Tmostly conserved

190Amostly conserved

200Tmostly conserved

202Amostly conserved

220Tmostly conserved

325Gmostly conserved

415Tmostly conserved

418Amostly conserved

433Amostly conserved

526Gmostly conserved

628Tmostly conserved

646Tmostly conserved

AATAATTTATTTTATTTTTGCTTTATGATCAGGAATGATTGGAACTTCTATAAGTATATTAATCCGTATAGAATTAAGGGTTCCTGGGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes5

BINs2

Most divergent pair3.3%

EuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora bomboidessame genus9.7%Anthophora quadrimaculatasame genus9.9%Anthophora dufouriisame genus9.9%Anthophora mucidasame genus10.0%Anthophora vannigerasame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type767 records

Wild obs. + sensor132

Museum / vouchered593

Other42

Origin

Native177

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 45≤1 km 20≤10 km 31>10 km 4

100 georeferenced · 32 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 7≤1 km 34≤10 km 479>10 km 16

536 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence593

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	182
Paro, BT	81
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	36
Wuzhou, CN	32
Museum zu Allerheiligen Schaffhausenlocation not on record	26
Bern, CH	23
Provincia di Livornolocation not on record	22
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	14
	12
ZSMlocation not on record	12
Sion, CH	12
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Philadelphia, US	6
Cambridge, US	5
PRAZlocation not on record	4
NMOKlocation not on record	3
Beltsville, US	3
Geneva, CH	2
Musee d'Histoire Naturallelocation not on record	2
Universität Zürich, Naturhistorisches Museumlocation not on record	1
Bonn, DE	1
Bavarian State Collection of Zoologylocation not on record	1
MNHWlocation not on record	1
MZLUlocation not on record	1

24 institutions · 492 of 593 vouchered records shown · 101 without an institution code

09Environmental DNA20 detections

Where the DNA of Anthophora pubescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 16.3–20.2

Seasonal swing summer↔winter19.2 °C

Max temp (day)23.4 °C 20.4–25.1

Min temp (night)14.5 °C 10.8–15.2

Precipitation58.4 mm/mo 47.2–123

Air humidity57.4 % 55.5–58.0

Moisture balance-57.5 mm/mo -77.7–-13.3

Vapour deficit937 Pa 778–1,056

Wind speed3.20 m/s 2.40–3.70

Cloud cover36.3 % 34.2–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)