Anthophora peritomae

Cockerell, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records1 097

Data sources6

Biological traits0

DNA specimens8

eDNA detections6

Sources6 archives

Databases and archives Anthophora peritomae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 097 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 097 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anthophora peritomae is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1905 door Cockerell.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora peritomae has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.54%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 9 variable positions, in barcode order

40Cmostly conserved

82Cmostly conserved

85Cmostly conserved

197Tmostly conserved

217Gvariable

343Tmostly conserved

499Tmostly conserved

616Tvariable

634Tmostly conserved

GATAATTTATTTTATATTTGCTTTGTGGTCTGGGATGGTCGGAACAGCTATAAGAATAATTATTCGTATAGAATTAAGGGCCCCCGGAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora quadrimaculatasame genus12.5%Anthophora mucidasame genus12.6%Anthophora pubescenssame genus12.8%Anthophora bomboidessame genus12.8%Anthophora porteraesame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 097 records

Wild obs. + sensor5

Museum / vouchered1 092

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 5≤10 km 4>10 km 1

10 georeferenced · 1 082 without coordinates

Open the institutions mapphysical evidence1 092

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	1 013
Wuzhou, CN	32
	17
Royal Saskatchewan Museumlocation not on record	9
WIlocation not on record	8
Natural History Museum of Utahlocation not on record	7
Oregon State Arthropod Collectionlocation not on record	2
Cambridge, US	1
OSUClocation not on record	1
WSUClocation not on record	1
Champaign, US	1

11 institutions · 1 092 of 1 092 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Anthophora peritomae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 18.1–18.1

Seasonal swing summer↔winter28.1 °C

Max temp (day)25.5 °C

Min temp (night)12.9 °C 12.8–12.9

Precipitation33.7 mm/mo 32.8–33.7

Air humidity52.4 % 52.2–52.4

Moisture balance-107 mm/mo -107–-107

Vapour deficit995 Pa 995–999

Wind speed3.80 m/s 3.60–3.80

Cloud cover32.4 % 32.2–32.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora peritomae

At a glance

Sources6 archives

At a glance

Record type1 097 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 097 records