Anthophora californica

Cresson, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records4 391

Data sources9

Biological traits1

DNA specimens34

eDNA detections28

Sources9 archives

Databases and archives Anthophora californica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 391 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF4 391 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · TreeOfSex2n = 38

01Narrative

Anthophora californica is a species of anthophorine bee in the family Apidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.31 mm

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora californica has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

1Amostly conserved

34Tmostly conserved

46Amostly conserved

82Tmostly conserved

85Gvariable

109Gmostly conserved

139Gmostly conserved

163Tmostly conserved

181Amostly conserved

202Tmostly conserved

208Gvariable

220Amostly conserved

235Tmostly conserved

266Tvariable

271Cmostly conserved

274Gmostly conserved

316Amostly conserved

322Tmostly conserved

328Tmostly conserved

335Gmostly conserved

340Tmostly conserved

343Cmostly conserved

358Tvariable

361Amostly conserved

373Tmostly conserved

439Gmostly conserved

478Tmostly conserved

490Tmostly conserved

514Gmostly conserved

538Gvariable

562Gmostly conserved

616Tvariable

632Gmostly conserved

637Tmostly conserved

639Tmostly conserved

640Avariable

651Amostly conserved

AATAATTTATTTTATTTTTGCTTTATGATCAGGTTTAATTGGAACATCAATAAGAATGATTATTCGAATAGAATTAAGGGCTCCGGGAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes19

BINs3

Most divergent pair4.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora crinipessame genus11.6%Anthophora abruptasame genus11.6%Anthophora bomboidessame genus11.7%Anthophora femoratasame genus11.9%Anthophora affinissame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anthophora californica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome records38–382n range38median38mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 191×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type4 391 records

Wild obs. + sensor2 392

Museum / vouchered1 918

Other81

Origin

Native55

Range

Area of Occupancy AOO6 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 352≤1 km 423≤10 km 78>10 km 216

2 069 georeferenced · 323 without coordinates

Open the mapobservation + sensor2 392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 188≤1 km 21≤10 km 112>10 km 26

347 georeferenced · 1 571 without coordinates

Open the institutions mapphysical evidence1 918

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	538
Wuzhou, CN	402
	306
University of Alabamalocation not on record	84
Ciudad de México, MX	84
Mexico City, MX	80
Los Angeles, US	55
Albuquerque, US	50
Champaign, US	32
College Station, US	27
Cambridge, US	26
Universidad de las Américas, Pueblalocation not on record	21
San Nicolás de los Garza, MX	20
Oregon State Arthropod Collectionlocation not on record	20
La Jolla, US	20
San Diego, US	20
WIlocation not on record	19
OSUClocation not on record	16
Santa Cruz, US	13
Tapachula, MX	12
ASUlocation not on record	11
US	11
University of California, Davislocation not on record	8
Santa Barbara Museum of Natural Historylocation not on record	8
Lubbock, US	4
US	3
Natural History Museum of Los Angeles County, Entomology Sectionlocation not on record	3
Colorado State Universitylocation not on record	3
University of California, Davis, Bohart Museum of Entomologylocation not on record	2
US	2
WSUClocation not on record	2
EL PASO, US	2
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	2
UWYMEDlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Awka, NG	1

36 institutions · 1 909 of 1 918 vouchered records shown · 9 without an institution code

09Environmental DNA28 detections

Where the DNA of Anthophora californica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

citrus grove

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 18.0–28.1

Seasonal swing summer↔winter18.9 °C

Max temp (day)30.8 °C 23.4–34.4

Min temp (night)16.2 °C 12.1–21.9

Precipitation64.7 mm/mo 7.40–107

Air humidity47.6 % 36.8–58.2

Moisture balance-105 mm/mo -188–-40.1

Vapour deficit1,665 Pa 942–2,228

Wind speed2.30 m/s 1.20–3.40

Cloud cover18.2 % 14.6–30.2

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora californica

At a glance

Sources9 archives

Size & morphology1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 391 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 391 records