Anthophora abrupta

Say, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records2 254

Data sources7

Biological traits1

DNA specimens23

eDNA detections23

Sources7 archives

Databases and archives Anthophora abrupta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 254 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anthophora abrupta is a species of anthophorine bee in the family Apidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.7 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora abrupta has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Amostly conserved

217Tvariable

307Tmostly conserved

490Cvariable

544Gmostly conserved

559Amostly conserved

596Amostly conserved

598Tmostly conserved

604Tmostly conserved

605Tmostly conserved

622Gmostly conserved

625Amostly conserved

628Tmostly conserved

631Amostly conserved

637Amostly conserved

638Gmostly conserved

645Amostly conserved

AATAATTTATTTTATTTTTGCTATATGATCTGGGTTGATTGGGACTTCTATAAGAATAATTATTCGTATAGAATTAAGAGTTCCAGGAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes8

BIN1

Most divergent pair14.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora bomboidessame genus4.6%Anthophora occidentalissame genus5.3%Anthophora plagiatasame genus5.7%Anthophora nigricepssame genus8.9%Anthophora canescenssame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 254 records

Wild obs. + sensor1 417

Museum / vouchered837

Range

Area of Occupancy AOO4 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 748≤1 km 213≤10 km 54>10 km 139

1 154 georeferenced · 263 without coordinates

Open the mapobservation + sensor1 417

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 6≤1 km 7≤10 km 123>10 km 34

170 georeferenced · 667 without coordinates

Open the institutions mapphysical evidence837

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	222
	122
Champaign, US	94
OSUClocation not on record	73
North Carolina State University Insect Museumlocation not on record	67
University Park, US	65
Wuzhou, CN	57
Cambridge, US	41
Beltsville, US	34
Mississippi State, US	12
Blacksburg, US	8
Philadelphia, US	8
Philadelphia, US	4
LULlocation not on record	3
College Station, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
University of Alabamalocation not on record	2
Cornell University Insect Collectionlocation not on record	2
UNHClocation not on record	2
US	1
New Haven, US	1
Provo, US	1
Washington, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
CUlocation not on record	1
New Haven, US	1

26 institutions · 827 of 837 vouchered records shown · 10 without an institution code

09Environmental DNA23 detections

Where the DNA of Anthophora abrupta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

UrbanGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 18.4–23.0

Seasonal swing summer↔winter24.4 °C

Max temp (day)25.1 °C 23.7–28.1

Min temp (night)14.5 °C 12.9–18.4

Precipitation115 mm/mo 92.7–137

Air humidity56.3 % 56.2–58.3

Moisture balance-28.5 mm/mo -67.2–-22.6

Vapour deficit981 Pa 921–1,173

Wind speed2.80 m/s 2.60–5.50

Cloud cover40.3 % 35.7–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora abrupta

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 254 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 254 records