Anoplodera rufipes

(Schaller, 1783) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anoplodera

At a glance

Occurrence records847

Data sources7

Biological traits0

DNA specimens11

eDNA detections8

Sources7 archives

Databases and archives Anoplodera rufipes's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility847 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF847 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD11 specimens

01Narrative

Der Rotbeiniger Halsbock (Anoplodera rufipes, Syn.: Leptura rufipes) ist ein Käfer aus der Familie der Bockkäfer (Cerambycidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplodera rufipes has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections8

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

10Cmostly conserved

28Amostly conserved

34Amostly conserved

49Gmostly conserved

70Tmostly conserved

79Cmostly conserved

82Tmostly conserved

100Tmostly conserved

148Amostly conserved

181Amostly conserved

205Tmostly conserved

217Gmostly conserved

262Gmostly conserved

271Amostly conserved

304Gmostly conserved

361Tmostly conserved

409Gmostly conserved

412Tmostly conserved

433Cmostly conserved

454Tmostly conserved

508Cmostly conserved

514Cmostly conserved

538Amostly conserved

557Tmostly conserved

634Tmostly conserved

641Tmostly conserved

646Tmostly conserved

AACTTTATACTTCCTATTTGGAGCTTGAGCTAGAATAGTAGGAACCTCGTTAAGACTATTAATTCGATCTGAATTAGGCAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes7

BINs2

Most divergent pair3.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplodera sexguttatasame genus10.3%Anoplodera puberasame genus11.7%Pentaria trifasciatasame order13.3%Onthophagus stockwellisame order13.3%Anastrangalia sanguinolentasame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type847 records

Wild obs. + sensor755

Museum / vouchered58

Other34

Range

Area of Occupancy AOO1 912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 110≤1 km 67≤10 km 413>10 km 78

668 georeferenced · 87 without coordinates

Open the mapobservation + sensor755

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤1 km 5≤10 km 29>10 km 7

42 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	5
NTNU-VMlocation not on record	4
Nijmegen, NL	2
GVlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
IFR-DNFlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
MZLUlocation not on record	1

8 institutions · 18 of 58 vouchered records shown · 40 without an institution code

09Environmental DNA8 detections

Where the DNA of Anoplodera rufipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

Laubwald

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 8.80–16.6

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.9 °C 12.5–21.0

Min temp (night)9.30 °C 5.00–10.9

Precipitation65.5 mm/mo 53.5–105

Air humidity58.2 % 56.3–62.4

Moisture balance-38.0 mm/mo -64.8–-12.1

Vapour deficit681 Pa 484–828

Wind speed3.50 m/s 3.20–4.30

Cloud cover37.1 % 32.7–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)