Anoplodera pubera

(Say, 1827) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anoplodera

At a glance

Occurrence records303

Data sources5

Biological traits0

DNA specimens13

eDNA detections13

Sources5 archives

Databases and archives Anoplodera pubera's data was compiled from.

GBIFGlobal Biodiversity Information Facility303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF303 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD13 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplodera pubera has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

25Cmostly conserved

37Gmostly conserved

43Cmostly conserved

67Gmostly conserved

118Tmostly conserved

238Cmostly conserved

268Cmostly conserved

271Amostly conserved

277Amostly conserved

295Gmostly conserved

316Gvariable

358Tmostly conserved

364Amostly conserved

475Tmostly conserved

542Tmostly conserved

556Cmostly conserved

637Gmostly conserved

646Tmostly conserved

AACTTTATATTTCTTATTTGGAGCCTGAGCAAGAATGGTAGGCACTTCTTTAAGACTATTAATTCGGTCAGAACTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes3

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplodera sexguttatasame genus10.8%Anoplodera rufipessame genus11.7%Strangalepta abbreviatasame family11.9%Pidonia puziloisame family13.3%Acmaeopsoides rufulasame family13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type303 records

Wild obs. + sensor222

Museum / vouchered81

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 104≤1 km 54≤10 km 16>10 km 21

195 georeferenced · 27 without coordinates

Open the mapobservation + sensor222

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤1 km 7≤10 km 15>10 km 3

25 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	51
Lexington, US	9
Champaign, US	8
Espace pour la vielocation not on record	5
University of Alberta Museums (UAM)location not on record	3
Royal Saskatchewan Museumlocation not on record	3
Lake Placid, US	1
Toronto, CA	1

8 institutions · 81 of 81 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Anoplodera pubera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 14.5–19.1

Seasonal swing summer↔winter31.8 °C

Max temp (day)22.6 °C 19.2–23.9

Min temp (night)13.9 °C 9.70–14.6

Precipitation96.0 mm/mo 87.7–140

Air humidity57.5 % 56.8–59.3

Moisture balance-35.4 mm/mo -51.7–3.40

Vapour deficit882 Pa 719–923

Wind speed2.60 m/s 2.50–2.70

Cloud cover41.2 % 39.0–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)