Annaphila diva

Grote, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Annaphila

At a glance

Occurrence records486

Data sources7

Biological traits0

DNA specimens12

eDNA detections10

Sources7 archives

Databases and archives Annaphila diva's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF486 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD12 specimens

01Narrative

Annaphila diva, also called the white annaphila, is a species of moth in the family Noctuidae (the owlet moths). It is found in North America. Adults' fore wings are black with white markings. Their hind wings are white bordered with black. Larvae are brown with dark bands and spots and white stripes. The host plant is miner's lettuce. The MONA or Hodges number for Annaphila diva is 9869.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annaphila diva has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

166Gmostly conserved

477Gmostly conserved

478Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTGCTAATTCGAGCTGAATTAGGTACCCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Annaphila scurlockorumsame genus3.8%Annaphila depictasame genus4.9%Annaphila idasame genus5.0%Annaphila superbasame genus5.9%Annaphila astrologasame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type486 records

Wild obs. + sensor357

Museum / vouchered129

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 164≤1 km 59≤10 km 30>10 km 15

268 georeferenced · 89 without coordinates

Open the mapobservation + sensor357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 3≤1 km 17≤10 km 13>10 km 3

36 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	35
Vernal, US	25
New Haven, US	15
Santa Cruz, US	14
University of Alberta Museums (UAM)location not on record	7
Washington, US	7
ASUlocation not on record	5
National Institute of Biological Resourceslocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
UNHClocation not on record	2
Essig Museum of Entomologylocation not on record	2
St. Paul, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
WWUlocation not on record	1
Chicago, US	1

15 institutions · 123 of 129 vouchered records shown · 6 without an institution code

09Environmental DNA10 detections

Where the DNA of Annaphila diva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 9.60–13.8

Seasonal swing summer↔winter16.1 °C

Max temp (day)16.6 °C 13.4–19.3

Min temp (night)5.70 °C 5.60–8.50

Precipitation92.2 mm/mo 79.9–176

Air humidity60.3 % 55.3–60.8

Moisture balance-10.8 mm/mo -27.2–72.0

Vapour deficit591 Pa 469–656

Wind speed2.00 m/s 1.90–2.80

Cloud cover48.5 % 47.8–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)