Annaphila astrologa

Barnes & McDunnough, 1918 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Annaphila

At a glance

Occurrence records71

Data sources7

Biological traits0

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Annaphila astrologa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF71 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Annaphila astrologa is a moth in the family Noctuidae (the owlet moths) first described by William Barnes and James Halliday McDunnough in 1918. It is found in North America. The MONA or Hodges number for Annaphila astrologa is 9857.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annaphila astrologa has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.9%

Haplotypes2

BINs2

Most divergent pair3.7%

Where individuals differ — all 25 variable positions, in barcode order

37Avariable

56Cvariable

76Tvariable

157Gvariable

166Tvariable

196Gvariable

202Tvariable

209Cvariable

235Tvariable

256Cvariable

289Cvariable

361Cvariable

373Cvariable

383Cvariable

403Tvariable

436Tvariable

481Avariable

496Tvariable

553Avariable

559Cvariable

565Cvariable

571Avariable

580Cvariable

625Avariable

643Cvariable

ATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGTACCCCCGGATCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Annaphila scurlockorumsame genus4.7%Annaphila idasame genus5.5%Annaphila depictasame genus5.5%Annaphila superbasame genus5.7%Annaphila castasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type71 records

Wild obs. + sensor56

Museum / vouchered15

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 36≤1 km 8≤10 km 3>10 km 1

48 georeferenced · 8 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 3≤1 km 7≤10 km 1

11 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	7
Washington, US	4
New Haven, US	3
Georgia Museum of Natural Historylocation not on record	1

4 institutions · 15 of 15 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Annaphila astrologa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter20.3 °C

Max temp (day)19.2 °C

Min temp (night)6.10 °C

Precipitation44.8 mm/mo

Air humidity53.0 %

Moisture balance-64.2 mm/mo

Vapour deficit689 Pa

Wind speed1.60 m/s

Cloud cover46.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)