Anisodactylus nigerrimus

(Dejean, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records254

Data sources6

Biological traits0

DNA specimens42

eDNA detections3

Sources6 archives

Databases and archives Anisodactylus nigerrimus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD42 specimens

01Narrative

Anisodactylus nigerrimus is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus nigerrimus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

34Amostly conserved

88Tmostly conserved

197Tmostly conserved

250Cvariable

271Cmostly conserved

304Gmostly conserved

316Gmostly conserved

373Amostly conserved

628Amostly conserved

634Cmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes15

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus kirbyisame genus1.8%Anisodactylus californicussame genus2.3%Anisodactylus lodingisame genus2.6%Anisodactylus agricolasame genus4.1%Anisodactylus nemorivagussame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type254 records

Wild obs. + sensor16

Museum / vouchered238

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 12≤1 km 2≤10 km 1

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 78≤1 km 3≤10 km 54>10 km 4

139 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	99
OSUClocation not on record	30
University of Alberta Museums (UAM)location not on record	20
University Park, US	10
Decorah, US	6
NEON Biorepository at Arizona State Universitylocation not on record	5
Provo, US	4
Espace pour la vielocation not on record	4
Saint John, CA	4
Royal Saskatchewan Museumlocation not on record	3
University of Guelphlocation not on record	2
North Carolina State University Insect Museumlocation not on record	2
Cambridge, US	1
CUlocation not on record	1
Lubbock, US	1
Essig Museum of Entomologylocation not on record	1

16 institutions · 193 of 238 vouchered records shown · 45 without an institution code

09Environmental DNA3 detections

Where the DNA of Anisodactylus nigerrimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

deciduousForestpastureHay

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 19.7–24.3

Seasonal swing summer↔winter21.7 °C

Max temp (day)25.5 °C 24.6–29.1

Min temp (night)15.8 °C 14.6–20.0

Precipitation124 mm/mo 110–130

Air humidity60.5 % 58.5–61.3

Moisture balance-22.5 mm/mo -30.4–-22.2

Vapour deficit947 Pa 930–1,206

Wind speed2.60 m/s 2.10–2.60

Cloud cover28.9 % 28.8–37.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)