Anisodactylus nemorivagus

(Duftschmid, 1812) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records1 323

Data sources6

Biological traits1

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Anisodactylus nemorivagus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 323 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 323 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anisodactylus nemorivagus is a species of ground beetle native to Europe.Fauna EuropaeaCarl H. Lindroth 1974 Coleoptera. Carabidae. Handbooks for the Identification of British Insects Vol 4 Part 2. Royal Entomological Society,London pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)herbivore

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus nemorivagus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTCATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGTATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus binotatussame genus2.3%Anisodactylus melanopussame genus3.9%Anisodactylus nigritasame genus4.0%Anisodactylus furvussame genus4.1%Anisodactylus harrisiisame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 323 records

Wild obs. + sensor698

Museum / vouchered561

Fossil3

Other61

Origin

Native428

Range

Area of Occupancy AOO1 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 80≤1 km 81≤10 km 512

673 georeferenced · 25 without coordinates

Open the mapobservation + sensor698

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 43≤10 km 468>10 km 19

531 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence561

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	89
Paro, BT	47
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	44
Zürich, CH	35
EIBElocation not on record	22
Provincia di Livornolocation not on record	21
Musee d'Histoire Naturallelocation not on record	16
Geneva, CH	14
Adam Mickiewicz University in Poznańlocation not on record	12
Vitoria, ES	12
Helsinki, FI	11
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	9
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	8
Salzburg, AT	7
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	6
Uniwersytet Wrocławskilocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
NCMGlocation not on record	3
ZSMlocation not on record	3
Frauenfeld, CH	2
Bavarian State Collection of Zoologylocation not on record	2
CBDClocation not on record	1
BioFokuslocation not on record	1
IFR-DNFlocation not on record	1
MZLUlocation not on record	1

25 institutions · 377 of 561 vouchered records shown · 184 without an institution code

09Environmental DNA5 detections

Where the DNA of Anisodactylus nemorivagus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 5.90–15.7

Seasonal swing summer↔winter18.1 °C

Max temp (day)17.2 °C 10.0–19.8

Min temp (night)8.20 °C -0.1–10.5

Precipitation68.9 mm/mo 66.6–147

Air humidity59.3 % 59.1–62.9

Moisture balance-32.8 mm/mo -38.9–37.7

Vapour deficit616 Pa 355–731

Wind speed2.80 m/s 2.40–5.30

Cloud cover35.9 % 32.9–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anisodactylus nemorivagus

At a glance

Sources6 archives

Diet & foraging1

At a glance

Record type1 323 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 323 records