Anisodactylus kirbyi

Lindroth, 1953 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records173

Data sources6

Biological traits0

DNA specimens7

eDNA detections6

Sources6 archives

Databases and archives Anisodactylus kirbyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anisodactylus kirbyi is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus kirbyi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.75%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 11 variable positions, in barcode order

235Tmostly conserved

244Avariable

318Cmostly conserved

385Cmostly conserved

466Gmostly conserved

520Amostly conserved

529Gvariable

578Cvariable

581Tvariable

634Tvariable

637Avariable

AACATTATATTTCATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus nigerrimussame genus1.8%Anisodactylus melanopussame genus2.2%Anisodactylus nigritasame genus2.3%Anisodactylus harrisiisame genus2.4%Anisodactylus lodingisame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor4

Museum / vouchered169

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 10≤1 km 2≤10 km 73>10 km 4

89 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	57
Espace pour la vielocation not on record	14
Saint John, CA	13
Tempe, US	8
University of Alabamalocation not on record	8
OSUClocation not on record	4
Royal Saskatchewan Museumlocation not on record	2
Provo, US	1
NEON Biorepository at Arizona State Universitylocation not on record	1
Champaign, US	1

10 institutions · 109 of 169 vouchered records shown · 60 without an institution code

09Environmental DNA6 detections

Where the DNA of Anisodactylus kirbyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

grasslandHerbaceousemergentHerbaceousWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 9.80–20.1

Seasonal swing summer↔winter32.4 °C

Max temp (day)24.5 °C 15.5–26.1

Min temp (night)14.0 °C 4.10–15.7

Precipitation73.8 mm/mo 56.6–90.5

Air humidity57.3 % 54.0–57.7

Moisture balance-74.8 mm/mo -90.4–-47.8

Vapour deficit912 Pa 580–1000

Wind speed4.60 m/s 3.20–4.90

Cloud cover35.8 % 31.1–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)