Anisodactylus agricola

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records213

Data sources6

Biological traits0

DNA specimens47

eDNA detections44

Sources6 archives

Databases and archives Anisodactylus agricola's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility213 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF213 records

Environmental DNA1 datasets · 2 countries44 detections

DNA & barcodingBOLD47 specimens

01Narrative

Anisodactylus agricola is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus agricola has left across the world's sequence archives.

At a glance

DNA specimens47

BINs2

Marker genes1

eDNA detections44

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

277Gmostly conserved

312Gmostly conserved

607Cmostly conserved

622Gmostly conserved

AACATTATATTTCATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.65%

Haplotypes6

BINs2

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus californicussame genus2.7%Anisodactylus lodingisame genus3.0%Anisodactylus nigritasame genus3.8%Anisodactylus harrisiisame genus3.8%Anisodactylus melanopussame genus3.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type213 records

Wild obs. + sensor1

Museum / vouchered212

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 128≤10 km 6>10 km 1

135 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	150
OSUClocation not on record	32
Decorah, US	13
Provo, US	5
University of Alberta Museums (UAM)location not on record	3
NEON Biorepository at Arizona State Universitylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
CUlocation not on record	1
Cambridge, US	1
EWIClocation not on record	1

10 institutions · 209 of 212 vouchered records shown · 3 without an institution code

09Environmental DNA44 detections

Where the DNA of Anisodactylus agricola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map2 countries0

deciduousForestpastureHayGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 12.6–24.3

Seasonal swing summer↔winter27.4 °C

Max temp (day)27.7 °C 18.1–29.5

Min temp (night)16.8 °C 7.90–19.4

Precipitation98.9 mm/mo 89.3–155

Air humidity56.7 % 55.4–58.1

Moisture balance-25.9 mm/mo -70.4–-7.40

Vapour deficit1,168 Pa 666–1,301

Wind speed3.50 m/s 3.00–4.70

Cloud cover36.6 % 32.4–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)