Andrena walleyi

Cockerell, 1932 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records41

Data sources6

Biological traits1

DNA specimens7

eDNA detections22

Sources6 archives

Databases and archives Andrena walleyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD7 specimens

01Narrative

Andrena walleyi is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1932 door Cockerell.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.87 mm

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena walleyi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.21%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 4 variable positions, in barcode order

88Amostly conserved

358Tmostly conserved

441Amostly conserved

457Tmostly conserved

AATACTATACTTCATTTTCGCTATATGAGCAGGTATAATTGGAGCCTCCCTAAGATTTATTATTCGTATAGAATTAAGAAATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena scurrasame genus7.4%Andrena montrosensissame genus8.4%Andrena sladenisame genus8.5%Andrena merriamisame genus8.5%Andrena mackieaesame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Museum / vouchered38

Other3

Range

Area of Occupancy AOO120 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence38

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	23
WSUClocation not on record	5
Champaign, US	5
Wuzhou, CN	2
Weber State University, Bird and Mammal Collectionlocation not on record	2
	1

6 institutions · 38 of 38 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Andrena walleyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Stabilizing dune1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.00 °C 8.00–15.2

Seasonal swing summer↔winter22.6 °C

Max temp (day)13.9 °C 13.9–20.7

Min temp (night)1.40 °C 1.40–7.90

Precipitation20.6 mm/mo 20.6–66.1

Air humidity53.0 % 47.9–53.0

Moisture balance-92.2 mm/mo -122–-76.9

Vapour deficit507 Pa 507–898

Wind speed3.60 m/s 2.70–3.60

Cloud cover37.7 % 37.7–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)