Andrena sladeni

Viereck, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records79

Data sources7

Biological traits0

DNA specimens10

eDNA detections5

Sources7 archives

Databases and archives Andrena sladeni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD10 specimens

01Narrative

The Sladen's miner bee (Andrena sladeni) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena sladeni has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.50%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 8 variable positions, in barcode order

334Cmostly conserved

355Tmostly conserved

400Cmostly conserved

499Cmostly conserved

538Amostly conserved

544Cmostly conserved

574Tmostly conserved

643Gmostly conserved

AATATTATATTTCATTTTCGCTATATGAGCAGGAATAATTGGAGCCTCCCTAAGATTCATTATCCGTATAGAATTAAGAAATCCCGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena scurrasame genus5.3%Andrena montrosensissame genus7.1%Andrena viereckisame genus7.4%Andrena merriamisame genus7.9%Andrena walleyisame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor2

Museum / vouchered76

Other1

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 25

26 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	28
WSUClocation not on record	26
Weber State University, Bird and Mammal Collectionlocation not on record	12
Royal British Columbia Museumlocation not on record	3
Champaign, US	3
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
Vancouver, CA	1
	1

8 institutions · 76 of 76 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Andrena sladeni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.00 °C 3.20–10.0

Seasonal swing summer↔winter22.1 °C

Max temp (day)8.20 °C 7.80–15.6

Min temp (night)-1.60 °C -2.90–3.60

Precipitation30.0 mm/mo 28.5–35.8

Air humidity53.8 % 53.2–54.0

Moisture balance-47.8 mm/mo -75.5–-37.1

Vapour deficit377 Pa 356–609

Wind speed3.00 m/s 2.30–3.00

Cloud cover42.8 % 41.7–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)