Andrena scurra

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records770

Data sources7

Biological traits0

DNA specimens42

eDNA detections42

Sources7 archives

Databases and archives Andrena scurra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility770 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF770 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD42 specimens

01Narrative

The joker miner bee (Andrena scurra) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena scurra has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair0.15%

AATATTATACTTCATTTTCGCTATATGAGCAGGAATAATCGGAGCCTCCCTAAGATTCATTATTCGTATAGAATTAAGAAACCCTGGTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena montrosensissame genus4.7%Andrena sladenisame genus5.3%Andrena merriamisame genus6.8%Andrena walleyisame genus7.4%Andrena viereckisame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type770 records

Museum / vouchered682

Other88

Range

Area of Occupancy AOO916 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 3≤1 km 6≤10 km 102>10 km 1

112 georeferenced · 570 without coordinates

Open the institutions mapphysical evidence682

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	374
WSUClocation not on record	105
Weber State University, Bird and Mammal Collectionlocation not on record	72
Wuzhou, CN	38
Champaign, US	31
WIlocation not on record	16
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	10
	9
Vancouver, CA	8
Cambridge, US	7
OSUClocation not on record	5
University of Guelphlocation not on record	2
US	2
Essig Museum of Entomologylocation not on record	2
Chicago, US	1

15 institutions · 682 of 682 vouchered records shown

09Environmental DNA42 detections

Where the DNA of Andrena scurra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 8.80–15.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)18.4 °C 14.1–21.8

Min temp (night)6.20 °C 2.50–8.00

Precipitation43.7 mm/mo 24.1–54.5

Air humidity52.2 % 47.0–54.3

Moisture balance-84.7 mm/mo -99.2–-63.9

Vapour deficit731 Pa 543–903

Wind speed2.70 m/s 1.50–3.60

Cloud cover40.6 % 32.4–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)