Andrena merriami

Cockerell, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records944

Data sources6

Biological traits1

DNA specimens15

eDNA detections0

Sources6 archives

Databases and archives Andrena merriami's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility944 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF944 records

DNA & barcodingBOLD15 specimens

01Narrative

Andrena merriami The Merriam's miner bee (Andrena merriami) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.87 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena merriami has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

316Gmostly conserved

340Cmostly conserved

565Gmostly conserved

628Tmostly conserved

AATATTATACTTCATTTTCGCTATATGAGCAGGAATAATTGGAGCATCCTTAAGATTTATCATTCGTATAGAATTAAGAAACCCTGGCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena scurrasame genus6.8%Andrena sladenisame genus7.9%Andrena montrosensissame genus8.4%Andrena walleyisame genus8.5%Andrena mackieaesame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type944 records

Wild obs. + sensor2

Museum / vouchered890

Other52

Range

Area of Occupancy AOO652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 18≤1 km 13≤10 km 217>10 km 1

249 georeferenced · 641 without coordinates

Open the institutions mapphysical evidence890

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	451
WSUClocation not on record	252
Weber State University, Bird and Mammal Collectionlocation not on record	57
Wuzhou, CN	48
Champaign, US	27
	17
Vancouver, CA	14
WIlocation not on record	11
Royal British Columbia Museumlocation not on record	4
Cambridge, US	2
US	2
Colorado State Universitylocation not on record	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
Washington, US	1

14 institutions · 890 of 890 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)