Andrena varians

(Kirby, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 070

Data sources7

Biological traits0

DNA specimens16

eDNA detections13

Sources7 archives

Databases and archives Andrena varians's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 070 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 070 records

Environmental DNA2 datasets · 5 countries13 detections

DNA & barcodingBOLD16 specimens

01Narrative

Andrena varians ist eine Sandbiene aus der Familie Andrenidae. Sie ist eine solitäre, nestbauende Biene, die jährlich eine Generation hat und in Deutschland von Anfang März oder April bis Mai fliegt. Auf Deutsch wird sie manchmal „Veränderliche Lockensandbiene“ genannt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena varians has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.24%

Haplotypes2

BIN1

Most divergent pair0.48%

Where individuals differ — all 3 variable positions, in barcode order

2Cmostly conserved

5Cmostly conserved

9Amostly conserved

ACCACAAAAATATTGGCATACTATACTTTATCTTCGCAATATGAGCAGGCATAATCGGAGCATCACTAAGATTTATTATTCGCATAGAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena helvolasame genus2.3%Andrena clarkellasame genus5.8%Andrena lapponicasame genus5.9%Andrena apicatasame genus6.2%Andrena mitissame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 070 records

Wild obs. + sensor293

Museum / vouchered748

Other29

Origin

Native64

Range

Area of Occupancy AOO1 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 103≤1 km 57≤10 km 114

274 georeferenced · 19 without coordinates

Open the mapobservation + sensor293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 2≤1 km 156≤10 km 393>10 km 40

591 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence748

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ULglocation not on record	176
Provincia di Livornolocation not on record	119
KZMlocation not on record	67
SLU Artdatabankenlocation not on record	62
Wuzhou, CN	45
Paro, BT	37
Zürich, CH	29
Bern, CH	19
Natural History Museum Rotterdamlocation not on record	18
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	18
Cambridge, US	18
	15
Bonn, DE	13
Philadelphia, US	12
Dhaka, BD	12
ZSMlocation not on record	11
Bavarian State Collection of Zoologylocation not on record	11
Sion, CH	6
NCMGlocation not on record	6
CBDClocation not on record	4
Musee d'Histoire Naturallelocation not on record	4
Frauenfeld, CH	4
Ghent, BE	4
Geneva, CH	3
MZLUlocation not on record	2
Mons, BE	2
Gothenburg, SE	2
PRUNlocation not on record	2
Natuurpuntlocation not on record	1
South Kensington, GB	1
Tromsø, NO	1

31 institutions · 724 of 748 vouchered records shown · 24 without an institution code

09Environmental DNA13 detections

Where the DNA of Andrena varians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C 8.20–12.5

Seasonal swing summer↔winter17.8 °C

Max temp (day)13.0 °C 11.1–16.8

Min temp (night)4.60 °C 3.00–7.80

Precipitation46.3 mm/mo 43.6–70.7

Air humidity59.1 % 58.2–61.4

Moisture balance-33.5 mm/mo -47.9–-12.0

Vapour deficit470 Pa 431–588

Wind speed3.50 m/s 2.50–4.50

Cloud cover39.5 % 37.0–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena varians

At a glance

Sources7 archives

At a glance

Record type1 070 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 070 records