Andrena apicata

Smith, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 400

Data sources7

Biological traits0

DNA specimens21

eDNA detections12

Sources7 archives

Databases and archives Andrena apicata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 400 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 400 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD21 specimens

01Narrative

Andrena apicata is a Palearctic species of mining bee.BWARSEdward Saunders 1896, The Hymenoptera Aculeata of the British Isles London. pdf us.archive Full text with illustrations]

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena apicata has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections12

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.67%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 16 variable positions, in barcode order

90Cmostly conserved

93Cmostly conserved

105Cmostly conserved

282Cmostly conserved

306Amostly conserved

357Tmostly conserved

417Tmostly conserved

423Amostly conserved

453Cmostly conserved

495Cmostly conserved

522Tmostly conserved

525Cmostly conserved

555Gmostly conserved

570Cmostly conserved

646Tmostly conserved

654Cmostly conserved

TTTATCTTCGCTATATGAGCAGGTATAATTGGAGCATCCCTAAGATTTATTATTCGCATAGAATTAAGAAATCCAGGAAACTGAATTAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena clarkellasame genus4.5%Andrena lapponicasame genus5.6%Andrena birtwellisame genus5.9%Andrena vicinoidessame genus6.0%Andrena nycthemerasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 400 records

Wild obs. + sensor818

Museum / vouchered576

Other6

Origin

Native119

Range

Area of Occupancy AOO2 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 354≤1 km 168≤10 km 262

784 georeferenced · 34 without coordinates

Open the mapobservation + sensor818

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 38≤1 km 88≤10 km 262>10 km 8

396 georeferenced · 180 without coordinates

Open the institutions mapphysical evidence576

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KZMlocation not on record	91
Provincia di Livornolocation not on record	61
SLU Artdatabankenlocation not on record	50
ULglocation not on record	38
Muzeum Górnośląskie w Bytomiulocation not on record	29
Zürich, CH	23
Bern, CH	22
Natural History Museum Rotterdamlocation not on record	22
Adam Mickiewicz University in Poznańlocation not on record	21
Musee d'Histoire Naturallelocation not on record	14
ZSMlocation not on record	12
Dhaka, BD	10
PRUNlocation not on record	8
Bavarian State Collection of Zoologylocation not on record	8
Trondheim, NO	7
Paro, BT	6
Tilburg, NL	5
Natuurpuntlocation not on record	4
PRAZlocation not on record	4
Philadelphia, US	3
	3
MZLUlocation not on record	3
NMOKlocation not on record	3
Nijmegen, NL	3
Beltsville, US	2
neflocation not on record	2
Mons, BE	2
MNHWlocation not on record	2
NCMGlocation not on record	2
NTNU-VMlocation not on record	1
CBDClocation not on record	1
Stockholm, SE	1
Research Collection of Christophe Prazlocation not on record	1
Bonn, DE	1
Uniwersytet Łódzkilocation not on record	1

35 institutions · 466 of 576 vouchered records shown · 110 without an institution code

09Environmental DNA12 detections

Where the DNA of Andrena apicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 4.20–13.0

Seasonal swing summer↔winter18.5 °C

Max temp (day)11.1 °C 7.60–17.4

Min temp (night)2.70 °C 0.7–8.30

Precipitation57.3 mm/mo 34.7–73.8

Air humidity60.3 % 58.1–62.8

Moisture balance-13.9 mm/mo -52.4–24.7

Vapour deficit391 Pa 300–633

Wind speed3.60 m/s 3.00–4.40

Cloud cover42.9 % 32.9–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena apicata

At a glance

Sources7 archives

At a glance

Record type1 400 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 400 records