Andrena mitis

Schmiedeknecht, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 205

Data sources7

Biological traits1

DNA specimens34

eDNA detections33

Sources7 archives

Databases and archives Andrena mitis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 205 records

Environmental DNA1 datasets · 7 countries33 detections

DNA & barcodingBOLD34 specimens

01Narrative

Andrena mitis ist eine Sandbiene aus der Familie Andrenidae. Sie ist eine solitäre, nestbauende Biene, die in Deutschland von Ende März bis Anfang Mai fliegt. Auf Deutsch wird sie manchmal „Auen-Lockensandbiene“ genannt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.31 mm

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena mitis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections33

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.01%

Haplotypes2

BIN1

Most divergent pair0.15%

TATACTATACTTTATCTTCGCTATATGAGCAGGTATAATTGGAGCATCCCTAAGATTTATTATTCGCATAGAATTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena clarkellasame genus4.3%Andrena lapponicasame genus5.8%Andrena vicinoidessame genus5.8%Andrena nycthemerasame genus6.2%Andrena birtwellisame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 205 records

Wild obs. + sensor528

Museum / vouchered673

Other4

Origin

Native243

Range

Area of Occupancy AOO1 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 21≤1 km 26≤10 km 455

502 georeferenced · 26 without coordinates

Open the mapobservation + sensor528

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 3≤1 km 105≤10 km 482>10 km 8

598 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence673

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	97
ULglocation not on record	69
Bern, CH	58
Zürich, CH	44
Natuurpuntlocation not on record	41
NMOKlocation not on record	32
Mons, BE	30
ZSMlocation not on record	24
Paro, BT	19
Musee d'Histoire Naturallelocation not on record	16
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	14
Natural History Museum Rotterdamlocation not on record	9
PRUNlocation not on record	9
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	8
Universität Zürich, Naturhistorisches Museumlocation not on record	6
PRAZlocation not on record	6
Bonn, DE	6
ARTlocation not on record	5
Bavarian State Collection of Zoologylocation not on record	5
Museum zu Allerheiligen Schaffhausenlocation not on record	4
Muzeum Górnośląskie w Bytomiulocation not on record	4
	3
Geneva, CH	2
IENElocation not on record	2
Tilburg, NL	2
Frauenfeld, CH	2
Wuzhou, CN	1

27 institutions · 518 of 673 vouchered records shown · 155 without an institution code

09Environmental DNA33 detections

Where the DNA of Andrena mitis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.40 °C 4.60–10.6

Seasonal swing summer↔winter18.7 °C

Max temp (day)13.5 °C 8.30–14.8

Min temp (night)4.70 °C 0.9–7.70

Precipitation60.8 mm/mo 43.5–90.0

Air humidity59.4 % 58.2–63.4

Moisture balance-26.0 mm/mo -33.5–-4.30

Vapour deficit476 Pa 333–531

Wind speed3.50 m/s 3.20–4.60

Cloud cover38.8 % 37.6–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena mitis

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 205 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 205 records