Andrena spiraeana

Robertson, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records683

Data sources7

Biological traits1

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Andrena spiraeana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility683 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF683 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

The goatsbeard miner bee (Andrena spiraeana) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.66 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena spiraeana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TATATTATATTTCATCTTCGCAATATGAGCTGGAATAATAGGAGCCTCATTAAGATTCATTATCCGAATAGAATTAAGAAATCCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena amphibolasame genus3.6%Andrena cupreotinctasame genus6.1%Andrena cyanophilasame genus6.4%Andrena cleodorasame genus7.0%Andrena forbesiisame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type683 records

Wild obs. + sensor5

Museum / vouchered678

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2>10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 6≤1 km 51≤10 km 129>10 km 5

191 georeferenced · 487 without coordinates

Open the institutions mapphysical evidence678

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	138
	135
US	81
Cornell University Insect Collectionlocation not on record	70
OSUClocation not on record	40
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	38
White River Junction, US	22
St. Paul, US	20
WIlocation not on record	18
University Park, US	16
Cambridge, US	13
Wuzhou, CN	13
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	11
Beltsville, US	11
UNHClocation not on record	8
Philadelphia, US	5
Chicago, US	5
New Haven, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Vermont Center for Ecostudieslocation not on record	1
LULlocation not on record	1
VTFPRlocation not on record	1
Middlebury Collegelocation not on record	1
Blacksburg, US	1
North Carolina State University Insect Museumlocation not on record	1
WSUClocation not on record	1

26 institutions · 659 of 678 vouchered records shown · 19 without an institution code

09Environmental DNA8 detections

Where the DNA of Andrena spiraeana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 12.1–18.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.9 °C 16.2–23.2

Min temp (night)8.20 °C 8.00–13.9

Precipitation88.1 mm/mo 83.3–92.5

Air humidity56.1 % 55.1–57.2

Moisture balance-37.7 mm/mo -54.3–-26.3

Vapour deficit681 Pa 619–923

Wind speed3.10 m/s 2.40–4.00

Cloud cover45.5 % 41.6–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)