Andrena forbesii

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records3 029

Data sources7

Biological traits3

DNA specimens36

eDNA detections43

Sources7 archives

Databases and archives Andrena forbesii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 029 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF3 029 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD36 specimens

01Narrative

The Forbes's miner bee (Andrena forbesii) is a species of miner bee in the family Andrenidae. Another common name for this species is the Forbes' andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length1 cm

Intertegular distance (ITD)2.38 mm

Wing length7.6 mm

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena forbesii has left across the world's sequence archives.

At a glance

DNA specimens36

BINs3

Marker genes1

eDNA detections43

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

4Amostly conserved

7Amostly conserved

16Cmostly conserved

19Cmostly conserved

31Amostly conserved

34Gvariable

46Cmostly conserved

50Tvariable

58Cvariable

74Tvariable

76Avariable

82Tmostly conserved

88Tvariable

97Tvariable

112Cvariable

118Tvariable

124Cmostly conserved

166Avariable

238Gvariable

256Gvariable

289Cvariable

303Tvariable

305Tvariable

316Amostly conserved

322Tmostly conserved

346Tvariable

361Cvariable

401Tvariable

415Amostly conserved

418Gvariable

427Tvariable

433Avariable

445Cvariable

473Avariable

479Avariable

484Cvariable

496Cvariable

533Tvariable

544Tvariable

578Cvariable

598Avariable

610Cmostly conserved

631Avariable

634Cvariable

646Cmostly conserved

652Tmostly conserved

TATACTATACTTCATCTTCGCAATATGAGCAGGGATAATAGGAGCCTCATTAAGATTCATTATTCGAATAGAATTAAGAAATCCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes3

BINs3

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena ceanothisame genus1.8%Andrena mirandasame genus3.8%Andrena rugosasame genus4.3%Andrena striatifronssame genus4.4%Andrena hippotessame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 029 records

Wild obs. + sensor7

Museum / vouchered3 011

Other11

Range

Area of Occupancy AOO2 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 2

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 17≤1 km 126≤10 km 960>10 km 59

1 162 georeferenced · 1 849 without coordinates

Open the institutions mapphysical evidence3 011

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	938
Cornell University Insect Collectionlocation not on record	488
	303
North Carolina State University Insect Museumlocation not on record	187
University Park, US	168
US	158
WIlocation not on record	126
Cambridge, US	95
Beltsville, US	74
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	54
UNHClocation not on record	46
New Haven, US	37
OSUClocation not on record	33
Lexington, US	30
Philadelphia, US	24
White River Junction, US	24
St. Paul, US	21
FWSlocation not on record	20
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	17
WSUClocation not on record	16
Colorado State Universitylocation not on record	14
Toronto, CA	14
LULlocation not on record	10
Chicago, US	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Toronto, CA	2
University of Central Floridalocation not on record	2
Wuzhou, CN	2
Universidad Católica de Manizaleslocation not on record	1
Blacksburg, US	1
York University, Packer Collectionlocation not on record	1
Saint John, CA	1
Vancouver, CA	1
University of Manitoba, Wallis Roughley Museum of Entomologylocation not on record	1

34 institutions · 2 921 of 3 011 vouchered records shown · 90 without an institution code

09Environmental DNA43 detections

Where the DNA of Andrena forbesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

farmForest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 9.00–15.2

Seasonal swing summer↔winter27.1 °C

Max temp (day)18.4 °C 14.0–20.4

Min temp (night)8.00 °C 3.00–11.5

Precipitation88.5 mm/mo 62.6–98.3

Air humidity55.6 % 54.4–61.2

Moisture balance-34.2 mm/mo -58.5–-11.3

Vapour deficit633 Pa 497–775

Wind speed3.40 m/s 2.70–4.80

Cloud cover45.5 % 40.6–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena forbesii

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type3 029 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 029 records