Andrena rugosa

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 690

Data sources6

Biological traits3

DNA specimens48

eDNA detections49

Sources6 archives

Databases and archives Andrena rugosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 690 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF1 690 records

Environmental DNA1 datasets · 1 countries49 detections

DNA & barcodingBOLD48 specimens

01Narrative

Andrena rugosa is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1891 door Robertson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length1.12 cm

Intertegular distance (ITD)2.64 mm

Wing length7 mm

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena rugosa has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

eDNA detections49

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

88Cmostly conserved

TATACTGTACTTCATCTTCGCAATATGAGCAGGAATAATAGGAGCCTCATTAAGATTCATTATCCGAATAGAATTAAGAAATCCAGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes10

BIN1

Most divergent pair0.30%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena striatifronssame genus4.1%Andrena forbesiisame genus4.3%Andrena mirandasame genus4.4%Andrena mariaesame genus4.6%Andrena ceanothisame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 690 records

Wild obs. + sensor69

Museum / vouchered1 618

Other3

Range

Area of Occupancy AOO1 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 24≤1 km 28≤10 km 3>10 km 6

61 georeferenced · 8 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 58≤1 km 114≤10 km 217>10 km 29

418 georeferenced · 1 200 without coordinates

Open the institutions mapphysical evidence1 618

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	316
	276
Champaign, US	159
US	116
White River Junction, US	114
University Park, US	104
Toronto, CA	90
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	69
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	68
New Haven, US	59
Cambridge, US	57
UNHClocation not on record	30
St. Paul, US	26
OSUClocation not on record	14
Philadelphia, US	13
LULlocation not on record	12
Vermont Center for Ecostudieslocation not on record	10
Beltsville, US	10
University of Central Floridalocation not on record	6
Toronto, CA	4
Chicago, US	4
VTFPRlocation not on record	4
Wuzhou, CN	3
North Carolina State University Insect Museumlocation not on record	2
FWSlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Colorado State Universitylocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Blacksburg, US	1
Decorah, US	1
New Haven, US	1

31 institutions · 1 575 of 1 618 vouchered records shown · 43 without an institution code

09Environmental DNA49 detections

Where the DNA of Andrena rugosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 5.40–14.1

Seasonal swing summer↔winter26.3 °C

Max temp (day)14.5 °C 9.80–19.1

Min temp (night)6.20 °C 1.30–9.50

Precipitation83.5 mm/mo 70.9–90.2

Air humidity56.6 % 55.2–61.7

Moisture balance-14.4 mm/mo -44.0–7.90

Vapour deficit493 Pa 413–675

Wind speed3.20 m/s 3.10–3.70

Cloud cover48.6 % 46.4–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena rugosa

At a glance

Sources6 archives

Size & morphology3

At a glance

Record type1 690 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 690 records