Andrena mariae

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 342

Data sources7

Biological traits0

DNA specimens11

eDNA detections2

Sources7 archives

Databases and archives Andrena mariae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 342 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 342 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD11 specimens

01Narrative

The Maria miner bee (Andrena mariae) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena mariae has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

70Gvariable

247Cmostly conserved

271Cmostly conserved

505Tvariable

571Cmostly conserved

610Cvariable

631Amostly conserved

641Tvariable

TATACTATATTTCATCTTCGCAATATGAGCAGGAATAATAGGAGCCTCATTAAGATTCATTATTCGTATGGAATTGAGAAATCCAGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes4

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena striatifronssame genus2.9%Andrena rugosasame genus4.6%Andrena forbesiisame genus4.6%Andrena nudasame genus4.7%Andrena hippotessame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 342 records

Wild obs. + sensor10

Museum / vouchered1 332

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 1

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 1≤1 km 188≤10 km 617>10 km 26

832 georeferenced · 500 without coordinates

Open the institutions mapphysical evidence1 332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	624
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	176
Universidad Católica de Manizaleslocation not on record	116
WIlocation not on record	78
	78
Cornell University Insect Collectionlocation not on record	66
Beltsville, US	25
WSUClocation not on record	19
Colorado State Universitylocation not on record	17
Cambridge, US	16
North Carolina State University Insect Museumlocation not on record	16
US	15
UNHClocation not on record	13
Toronto, CA	11
FWSlocation not on record	7
Chicago, US	7
Lexington, US	6
Royal Saskatchewan Museumlocation not on record	5
OSUClocation not on record	3
New Haven, US	2
University of Central Floridalocation not on record	2
White River Junction, US	1
Blacksburg, US	1
St. Paul, US	1
Awka, NG	1
Royal Saskatchewan Museumlocation not on record	1
Philadelphia, US	1

27 institutions · 1 308 of 1 332 vouchered records shown · 24 without an institution code

09Environmental DNA2 detections

Where the DNA of Andrena mariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.7–12.7

Seasonal swing summer↔winter24.9 °C

Max temp (day)19.1 °C

Min temp (night)6.80 °C

Precipitation80.8 mm/mo

Air humidity55.6 %

Moisture balance-37.3 mm/mo

Vapour deficit650 Pa

Wind speed1.90 m/s

Cloud cover36.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena mariae

At a glance

Sources7 archives

At a glance

Record type1 342 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 342 records