Andrena hippotes

Robertson, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records3 168

Data sources7

Biological traits3

DNA specimens33

eDNA detections39

Sources7 archives

Databases and archives Andrena hippotes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF3 168 records

Environmental DNA1 datasets · 2 countries39 detections

DNA & barcodingBOLD33 specimens

01Narrative

The Hippotes's miner bee (Andrena hippotes) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length0.87 cm

Intertegular distance (ITD)2.24 mm

Wing length7.6 mm

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena hippotes has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections39

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

4Gvariable

409Tmostly conserved

646Tvariable

TATGCTATACTTCATCTTTGCAATATGAGCAGGTATAATAGGAGCCTCACTAAGATTCATTATTCGAATAGAATTGAGAAATCCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena mirandasame genus4.1%Andrena sigmundisame genus4.4%Andrena forbesiisame genus4.4%Andrena striatifronssame genus4.6%Andrena mariaesame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 168 records

Wild obs. + sensor72

Museum / vouchered3 083

Other13

Range

Area of Occupancy AOO2 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 38≤1 km 18≤10 km 3>10 km 7

66 georeferenced · 6 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 38≤1 km 179≤10 km 821>10 km 22

1 060 georeferenced · 2 023 without coordinates

Open the institutions mapphysical evidence3 083

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	764
Cornell University Insect Collectionlocation not on record	486
	473
US	271
University Park, US	241
WIlocation not on record	204
Beltsville, US	88
White River Junction, US	68
Cambridge, US	58
New Haven, US	58
WSUClocation not on record	42
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	40
Universidad Católica de Manizaleslocation not on record	38
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	37
UNHClocation not on record	31
Toronto, CA	30
North Carolina State University Insect Museumlocation not on record	22
St. Paul, US	21
Toronto, CA	14
Colorado State Universitylocation not on record	14
Vancouver, CA	10
Lexington, US	9
Weber State University, Bird and Mammal Collectionlocation not on record	7
Royal Saskatchewan Museumlocation not on record	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Chicago, US	6
LULlocation not on record	5
OSUClocation not on record	4
Decorah, US	2
New Haven, US	2
FWSlocation not on record	1
Blacksburg, US	1
Philadelphia, US	1
Vermont Center for Ecostudieslocation not on record	1
Wuzhou, CN	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Roberts Creek, CA	1
BBSLlocation not on record	1

38 institutions · 3 065 of 3 083 vouchered records shown · 18 without an institution code

09Environmental DNA39 detections

Where the DNA of Andrena hippotes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map2 countries0

highbush blueberry cropsPrunus virginianaagricultural fieldAgricultural field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 9.70–13.7

Seasonal swing summer↔winter24.6 °C

Max temp (day)18.3 °C 13.3–19.1

Min temp (night)8.00 °C 4.90–10.1

Precipitation86.8 mm/mo 40.5–109

Air humidity55.6 % 52.6–60.7

Moisture balance-36.7 mm/mo -59.6–9.80

Vapour deficit656 Pa 482–696

Wind speed3.20 m/s 2.10–4.10

Cloud cover44.6 % 40.7–48.4

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena hippotes

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type3 168 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 168 records