Andrena sigmundi

Cockerell, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records685

Data sources7

Biological traits1

DNA specimens18

eDNA detections3

Sources7 archives

Databases and archives Andrena sigmundi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility685 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF685 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD18 specimens

01Narrative

The Sigmund's miner bee (Andrena sigmundi) is a species of miner bee in the family Andrenidae. Another common name for this species is the Sigmund's andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.1 mm

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena sigmundi has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

4Amostly conserved

7Amostly conserved

13Tmostly conserved

16Cmostly conserved

50Cmostly conserved

64Tmostly conserved

67Amostly conserved

74Tmostly conserved

76Gmostly conserved

88Cmostly conserved

97Cmostly conserved

112Cmostly conserved

115Tmostly conserved

118Tmostly conserved

130Amostly conserved

133Cmostly conserved

154Cmostly conserved

157Cmostly conserved

163Amostly conserved

313Amostly conserved

316Amostly conserved

343Cmostly conserved

346Cmostly conserved

347Tmostly conserved

358Cmostly conserved

364Cmostly conserved

370Amostly conserved

373Amostly conserved

406Tmostly conserved

412Amostly conserved

418Amostly conserved

427Cmostly conserved

442Tmostly conserved

479Amostly conserved

490Tmostly conserved

544Cmostly conserved

548Cmostly conserved

571Cmostly conserved

578Tmostly conserved

595Cmostly conserved

601Tmostly conserved

631Amostly conserved

TATACTATACTTTATCTTCGCAATATGAGCAGGAATAATAGGAGCCTCACTAAGATTCATTATTCGAATAGAATTGAGAAATCCAGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes4

BINs2

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena mirandasame genus2.7%Andrena hippotessame genus4.4%Andrena striatifronssame genus4.6%Andrena nudasame genus4.6%Andrena forbesiisame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type685 records

Wild obs. + sensor1

Museum / vouchered684

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 10≤1 km 56≤10 km 125>10 km 13

204 georeferenced · 480 without coordinates

Open the institutions mapphysical evidence684

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	113
WIlocation not on record	98
Cambridge, US	65
	64
Champaign, US	62
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	52
UNHClocation not on record	44
Wuzhou, CN	24
White River Junction, US	20
Toronto, CA	19
Beltsville, US	13
US	9
New Haven, US	7
St. Paul, US	7
North Carolina State University Insect Museumlocation not on record	4
OSUClocation not on record	3
Chicago, US	3
New Haven, US	2
Canadian Museum of Naturelocation not on record	1
Washington, US	1
Colorado State Universitylocation not on record	1
Sherwood Park, CA	1
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	1

23 institutions · 614 of 684 vouchered records shown · 70 without an institution code

09Environmental DNA3 detections

Where the DNA of Andrena sigmundi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Active dune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.1–17.7

Seasonal swing summer↔winter28.3 °C

Max temp (day)20.9 °C 18.6–23.1

Min temp (night)9.20 °C 6.20–12.1

Precipitation80.5 mm/mo 53.0–108

Air humidity54.8 % 53.5–56.0

Moisture balance-50.7 mm/mo -73.1–-28.2

Vapour deficit776 Pa 660–892

Wind speed3.50 m/s 2.90–4.00

Cloud cover41.7 % 41.1–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)