Andrena ceanothi

Viereck, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records439

Data sources7

Biological traits1

DNA specimens5

eDNA detections1

Sources7 archives

Databases and archives Andrena ceanothi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility439 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF439 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

The ceanothus miner bee (Andrena ceanothi) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.73 mm

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena ceanothi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)4.0%

Haplotypes1

BINs2

Where individuals differ — all 53 variable positions, in barcode order

34Gmostly conserved

67Amostly conserved

74Cmostly conserved

76Gmostly conserved

88Cmostly conserved

112Tmostly conserved

124Cmostly conserved

163Amostly conserved

166Gmostly conserved

256Gmostly conserved

259Cmostly conserved

263Cmostly conserved

268Cmostly conserved

289Cmostly conserved

316Amostly conserved

322Cmostly conserved

340Tmostly conserved

343Amostly conserved

361Cmostly conserved

367Tmostly conserved

373Cmostly conserved

385Tmostly conserved

394Tmostly conserved

397Tmostly conserved

401Tmostly conserved

406Tmostly conserved

416Gmostly conserved

418Gmostly conserved

433Amostly conserved

445Cmostly conserved

457Tmostly conserved

458Cmostly conserved

460Tmostly conserved

462Gmostly conserved

463Tmostly conserved

479Amostly conserved

496Cmostly conserved

499Amostly conserved

505Cmostly conserved

520Tmostly conserved

523Tmostly conserved

532Cmostly conserved

533Tmostly conserved

536Tmostly conserved

550Amostly conserved

557Tmostly conserved

568Cmostly conserved

571Cmostly conserved

581Cmostly conserved

595Tmostly conserved

628Amostly conserved

631Amostly conserved

640Tmostly conserved

TATACTATACTTCATCTTCGCAATATGAGCAGGGATAATAGGAGCCTCACTAAGATTTATTATTCGAATAGAACTGAGAAATCCAGGCAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena forbesiisame genus1.8%Andrena mirandasame genus4.4%Andrena nudasame genus4.9%Andrena rugosasame genus4.9%Andrena sigmundisame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type439 records

Museum / vouchered434

Other5

Range

Area of Occupancy AOO608 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 1≤1 km 23≤10 km 21>10 km 14

59 georeferenced · 375 without coordinates

Open the institutions mapphysical evidence434

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	58
US	55
University Park, US	54
Cornell University Insect Collectionlocation not on record	42
WIlocation not on record	33
UNHClocation not on record	23
Champaign, US	15
Cambridge, US	12
White River Junction, US	9
LULlocation not on record	7
OSUClocation not on record	3
Beltsville, US	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
Washington, US	1

14 institutions · 316 of 434 vouchered records shown · 118 without an institution code

09Environmental DNA1 detections

Where the DNA of Andrena ceanothi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)