Andrena cleodora

(Viereck, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records260

Data sources7

Biological traits0

DNA specimens5

eDNA detections19

Sources7 archives

Databases and archives Andrena cleodora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF260 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD5 specimens

01Narrative

The shiny-blue sculptured miner bee (Andrena cleodora) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena cleodora has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)3.6%

Haplotypes1

BINs2

Where individuals differ — all 44 variable positions, in barcode order

13Cvariable

14Avariable

19Tvariable

26Tvariable

46Amostly conserved

61Cmostly conserved

82Cmostly conserved

124Tmostly conserved

205Amostly conserved

238Amostly conserved

247Cmostly conserved

262Gmostly conserved

265Amostly conserved

295Cmostly conserved

304Cmostly conserved

316Gmostly conserved

346Cmostly conserved

358Tmostly conserved

364Tmostly conserved

367Tmostly conserved

373Amostly conserved

382Tmostly conserved

397Cmostly conserved

401Tmostly conserved

406Cmostly conserved

445Cmostly conserved

448Tmostly conserved

463Tmostly conserved

474Tmostly conserved

475Tmostly conserved

476Tmostly conserved

477Cmostly conserved

478Amostly conserved

481Amostly conserved

482Amostly conserved

483Amostly conserved

484Cmostly conserved

486Amostly conserved

487Cmostly conserved

500Cmostly conserved

550Tmostly conserved

562Cmostly conserved

607Amostly conserved

631Cvariable

TATATTATACTTCATCTTTGCAATATGAGCAGGAATAATAGGAGCATCTCTAAGATTTATCATTCGAATAGAATTAAGAAACCCAGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena cupreotinctasame genus4.9%Andrena cyanophilasame genus4.9%Andrena amphibolasame genus5.3%Andrena spiraeanasame genus7.0%Andrena striatifronssame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type260 records

Museum / vouchered118

Other142

Range

Area of Occupancy AOO400 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 6≤1 km 6≤10 km 51

63 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence118

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	52
	17
Beltsville, US	15
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	8
OSUClocation not on record	5
Vancouver, CA	4
Cambridge, US	2
WSUClocation not on record	2
WIlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Weber State University, Bird and Mammal Collectionlocation not on record	1
Royal Ontario Museumlocation not on record	1

12 institutions · 109 of 118 vouchered records shown · 9 without an institution code

09Environmental DNA19 detections

Where the DNA of Andrena cleodora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

Grassland1. Forest & Woodland | 1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 10.3–16.0

Seasonal swing summer↔winter23.4 °C

Max temp (day)18.5 °C 16.8–23.4

Min temp (night)6.20 °C 3.40–8.50

Precipitation45.4 mm/mo 20.4–83.1

Air humidity52.3 % 46.5–54.2

Moisture balance-91.1 mm/mo -147–-33.2

Vapour deficit713 Pa 630–942

Wind speed2.30 m/s 1.50–4.00

Cloud cover39.3 % 25.6–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)