Andrena amphibola

(Viereck, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records386

Data sources7

Biological traits0

DNA specimens9

eDNA detections1

Sources7 archives

Databases and archives Andrena amphibola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility386 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF386 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

The amphibious miner bee (Andrena amphibola) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena amphibola has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.67%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 12 variable positions, in barcode order

50Cmostly conserved

79Amostly conserved

100Tmostly conserved

289Cmostly conserved

305Cmostly conserved

343Cmostly conserved

364Tmostly conserved

418Tmostly conserved

490Tmostly conserved

535Avariable

556Tmostly conserved

562Tmostly conserved

TATATTATATTTCATCTTCGCAATATGAGCAGGAATAATAGGAGCCTCACTAAGATTCATTATTCGAATAGAATTAAGAAATCCAGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena spiraeanasame genus3.6%Andrena cupreotinctasame genus4.7%Andrena cyanophilasame genus4.7%Andrena cleodorasame genus5.3%Andrena forbesiisame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type386 records

Wild obs. + sensor8

Museum / vouchered345

Other33

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 5

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 4≤1 km 15≤10 km 72>10 km 3

94 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	128
Champaign, US	50
	29
San Francisco, US	24
Weber State University, Bird and Mammal Collectionlocation not on record	20
US	17
Essig Museum of Entomologylocation not on record	13
WSUClocation not on record	12
Colorado State Universitylocation not on record	11
Awka, NG	9
Royal Saskatchewan Museumlocation not on record	8
Vancouver, CA	7
Wuzhou, CN	5
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
Cambridge, US	2
WIlocation not on record	2
Natural History Museum of Utahlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
OSUClocation not on record	1
Sherwood Park, CA	1

20 institutions · 345 of 345 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Andrena amphibola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.9–13.9

Seasonal swing summer↔winter24.6 °C

Max temp (day)20.6 °C

Min temp (night)7.70 °C

Precipitation80.9 mm/mo

Air humidity54.0 %

Moisture balance-59.6 mm/mo

Vapour deficit736 Pa

Wind speed2.90 m/s

Cloud cover33.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)