Andrena sardoa

Lepeletier, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records136

Data sources5

Biological traits0

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Andrena sardoa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF136 records

DNA & barcodingBOLD5 specimens

01Narrative

Andrena sardoa is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1841 door Lepeletier.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena sardoa has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.28%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

354Cvariable

363Cvariable

429Avariable

TTATACTTCATTTTTGCAATATGATCAGGAATAATTGGAGCATCATTAAGATTTATTATTCGAATAGAATTAAGAAATCCAGGAAGCTGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena paucisquamasame genus9.8%Andrena curvungulasame genus9.8%Andrena pandelleisame genus10.0%Andrena florivagasame genus10.1%Andrena gamskruckisame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type136 records

Wild obs. + sensor48

Museum / vouchered16

Other72

Origin

Native1

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 12≤1 km 8≤10 km 4>10 km 1

25 georeferenced · 23 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤1 km 4≤10 km 3>10 km 2

9 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	5
Zürich, CH	5
IMEDEAlocation not on record	3
	2
Coimbra, PT	1

5 institutions · 16 of 16 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)