Andrena pandellei

Pérez, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 410

Data sources6

Biological traits1

DNA specimens31

eDNA detections16

Sources6 archives

Databases and archives Andrena pandellei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 410 records

Environmental DNA1 datasets · 5 countries16 detections

DNA & barcodingBOLD31 specimens

01Narrative

De donkere klokjeszandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1895 door Pérez.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.17 mm

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena pandellei has left across the world's sequence archives.

At a glance

DNA specimens31

BINs3

Marker genes1

eDNA detections16

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)3.1%

Haplotypes2

BINs3

Most divergent pair0.61%

Where individuals differ — all 42 variable positions, in barcode order

16Cvariable

43Avariable

49Gvariable

73Amostly conserved

100Cmostly conserved

112Cmostly conserved

115Cmostly conserved

118Tmostly conserved

127Amostly conserved

136Cmostly conserved

139Cmostly conserved

157Tmostly conserved

202Amostly conserved

212Tmostly conserved

229Gvariable

235Cvariable

282Tvariable

285Cvariable

290Tmostly conserved

294Cvariable

305Tvariable

316Tmostly conserved

343Tvariable

364Tmostly conserved

371Avariable

389Avariable

394Cvariable

397Cvariable

403Avariable

410Gmostly conserved

415Cvariable

427Cvariable

475Tvariable

494Tvariable

532Tvariable

536Tvariable

556Tmostly conserved

576Tmostly conserved

581Tvariable

634Tvariable

647Cvariable

652Tvariable

AATATTATACTTCATCTTCGCAATATGATCAGGTATAATTGGAGCATCGTTAAGATTTATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena paucisquamasame genus6.5%Andrena curvungulasame genus7.2%Andrena florivagasame genus8.1%Andrena mocsaryisame genus8.4%Andrena gamskruckisame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 410 records

Wild obs. + sensor616

Museum / vouchered758

Cultivated / captive1

Other35

Origin

Native351

Range

Area of Occupancy AOO1 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 57≤1 km 39≤10 km 471

567 georeferenced · 49 without coordinates

Open the mapobservation + sensor616

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 7≤1 km 167≤10 km 483>10 km 8

665 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence758

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	155
Zürich, CH	66
Musee d'Histoire Naturallelocation not on record	55
ULglocation not on record	36
ZSMlocation not on record	28
Bern, CH	25
Wuzhou, CN	17
Bonn, DE	15
Bavarian State Collection of Zoologylocation not on record	13
PRAZlocation not on record	12
NMOKlocation not on record	11
Dhaka, BD	11
Museum zu Allerheiligen Schaffhausenlocation not on record	10
	8
Geneva, CH	7
Paro, BT	4
Coimbra, PT	4
AGClocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
Naturhistorisches Museum Wienlocation not on record	3
Mons, BE	3
Natuurpuntlocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
MNHWlocation not on record	2
Fribourg, CH	2
PRUNlocation not on record	2
University of Florence, Department of Biologylocation not on record	1
Oberoesterreichisches Landesmuseum, Biologiezentrum, Linzlocation not on record	1
Arthropologia, Lyonlocation not on record	1

30 institutions · 507 of 758 vouchered records shown · 251 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Andrena pandellei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 12.7–20.9

Seasonal swing summer↔winter18.7 °C

Max temp (day)19.3 °C 16.9–24.0

Min temp (night)9.80 °C 7.90–16.8

Precipitation72.9 mm/mo 55.4–89.9

Air humidity58.1 % 57.3–58.9

Moisture balance-36.5 mm/mo -86.2–-27.1

Vapour deficit731 Pa 604–1,083

Wind speed2.90 m/s 2.30–3.80

Cloud cover35.2 % 33.0–37.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena pandellei

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 410 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 410 records