Andrena curvungula

Thomson, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 928

Data sources7

Biological traits1

DNA specimens28

eDNA detections11

Sources7 archives

Databases and archives Andrena curvungula's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 928 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 928 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD28 specimens

01Narrative

Andrena curvungula is a species of insect belonging to the family Andrenidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.38 mm

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena curvungula has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes1

eDNA detections11

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

9Cmostly conserved

12Tmostly conserved

27Amostly conserved

42Amostly conserved

46Tmostly conserved

63Amostly conserved

70Cmostly conserved

84Amostly conserved

86Gmostly conserved

111Cvariable

117Amostly conserved

123Cmostly conserved

125Cmostly conserved

129Cmostly conserved

141Tmostly conserved

147Tmostly conserved

162Amostly conserved

168Tmostly conserved

201Gmostly conserved

225Gmostly conserved

231Cmostly conserved

234Gmostly conserved

255Tmostly conserved

259Cmostly conserved

261Tmostly conserved

264Amostly conserved

267Tmostly conserved

282Tmostly conserved

286Tmostly conserved

290Cmostly conserved

300Cmostly conserved

334Tmostly conserved

336Cmostly conserved

339Cmostly conserved

342Amostly conserved

343Tmostly conserved

345Amostly conserved

351Amostly conserved

357Avariable

360Cmostly conserved

366Gmostly conserved

372Amostly conserved

375Tmostly conserved

387Gmostly conserved

390Cmostly conserved

402Tmostly conserved

405Tmostly conserved

414Tmostly conserved

423Cmostly conserved

441Tmostly conserved

443Tmostly conserved

444Tmostly conserved

447Amostly conserved

453Tmostly conserved

490Cmostly conserved

492Cmostly conserved

495Amostly conserved

501Tmostly conserved

502Amostly conserved

508Tmostly conserved

516Cmostly conserved

519Tmostly conserved

525Amostly conserved

543Amostly conserved

544Tmostly conserved

558Tmostly conserved

564Tmostly conserved

577Tmostly conserved

597Cmostly conserved

606Tmostly conserved

612Tmostly conserved

614Cmostly conserved

624Gmostly conserved

627Amostly conserved

630Tmostly conserved

639Tmostly conserved

TTATACTTCATTTTCGCAATATGATCAGGAATAATTGGAGCATCATTAAGATTCATTATTCGAATAGAACTAAGAAATCCAGGAAGCTGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes5

BINs2

Most divergent pair11.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena paucisquamasame genus6.7%Andrena pandelleisame genus7.2%Andrena mocsaryisame genus7.7%Andrena florivagasame genus8.1%Andrena dorsalissame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 928 records

Wild obs. + sensor814

Museum / vouchered1 093

Other21

Origin

Native509

Range

Area of Occupancy AOO2 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 230≤1 km 177≤10 km 360>10 km 3

770 georeferenced · 44 without coordinates

Open the mapobservation + sensor814

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 18≤1 km 134≤10 km 817>10 km 17

986 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence1 093

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee d'Histoire Naturallelocation not on record	124
Provincia di Livornolocation not on record	106
Bern, CH	85
Zürich, CH	64
Dhaka, BD	49
SLU Artdatabankenlocation not on record	39
Paro, BT	37
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	28
ZSMlocation not on record	26
Bonn, DE	24
ULglocation not on record	23
IENElocation not on record	22
NMOKlocation not on record	21
Bavarian State Collection of Zoologylocation not on record	17
MZLUlocation not on record	14
KZMlocation not on record	13
PRAZlocation not on record	13
Museum zu Allerheiligen Schaffhausenlocation not on record	12
PRUNlocation not on record	10
Natural History Museum Rotterdamlocation not on record	7
Geneva, CH	7
Mons, BE	7
Philadelphia, US	3
MNHWlocation not on record	3
Sion, CH	2
Haus der Natur, Salzburglocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	2
ARTlocation not on record	2
EIBElocation not on record	2
Wuzhou, CN	2
Champaign, US	1
Naturhistorisches Museum Wienlocation not on record	1
XII, Vlocation not on record	1
Stockholm, SE	1
Tilburg, NL	1

35 institutions · 771 of 1 093 vouchered records shown · 322 without an institution code

09Environmental DNA11 detections

Where the DNA of Andrena curvungula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 12.7–18.0

Seasonal swing summer↔winter18.2 °C

Max temp (day)19.1 °C 16.9–22.4

Min temp (night)9.50 °C 7.90–12.7

Precipitation72.1 mm/mo 57.5–98.1

Air humidity58.3 % 57.7–58.9

Moisture balance-38.3 mm/mo -56.1–-25.3

Vapour deficit709 Pa 604–871

Wind speed3.30 m/s 2.60–3.70

Cloud cover34.3 % 32.4–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena curvungula

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 928 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 928 records