Andrena florivaga

Eversmann, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records66

Data sources6

Biological traits0

DNA specimens11

eDNA detections9

Sources6 archives

Databases and archives Andrena florivaga's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF66 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD11 specimens

01Narrative

Andrena florivaga is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Eversmann.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena florivaga has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

142Cvariable

316Cvariable

347Tvariable

364Cvariable

484Tmostly conserved

505Cvariable

520Tvariable

631Tvariable

AATATTATACTTCATTTTCGCAATATGATCAGGAATAATTGGAGCATCACTAAGATTTATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes4

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena paucisquamasame genus7.3%Andrena mocsaryisame genus7.9%Andrena pandelleisame genus8.1%Andrena curvungulasame genus8.1%Andrena dorsalissame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type66 records

Wild obs. + sensor34

Museum / vouchered32

Origin

Native15

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 4≤1 km 1≤10 km 25>10 km 1

31 georeferenced · 3 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 2≤10 km 11

13 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	7
Musee d'Histoire Naturallelocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
PRAZlocation not on record	2
PRUNlocation not on record	2
Philadelphia, US	2
KZMlocation not on record	1
Provincia di Livornolocation not on record	1
NMOKlocation not on record	1

9 institutions · 24 of 32 vouchered records shown · 8 without an institution code

09Environmental DNA9 detections

Where the DNA of Andrena florivaga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 8.90–14.7

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.2 °C 13.1–18.9

Min temp (night)8.00 °C 3.60–9.10

Precipitation61.2 mm/mo 56.1–98.6

Air humidity58.3 % 57.6–59.9

Moisture balance-45.7 mm/mo -63.1–1.20

Vapour deficit673 Pa 479–705

Wind speed3.00 m/s 1.80–4.40

Cloud cover36.2 % 34.8–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)