Andrena nitidiuscula

Schenck, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 526

Data sources6

Biological traits1

DNA specimens23

eDNA detections26

Sources6 archives

Databases and archives Andrena nitidiuscula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 526 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 526 records

Environmental DNA1 datasets · 8 countries26 detections

DNA & barcodingBOLD23 specimens

01Narrative

De schermbloemzandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Schenck.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.97 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena nitidiuscula has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections26

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes1

BINs2

Where individuals differ — all 23 variable positions, in barcode order

271Cmostly conserved

274Tmostly conserved

281Cmostly conserved

290Cmostly conserved

302Gmostly conserved

316Amostly conserved

340Tmostly conserved

386Tmostly conserved

397Tmostly conserved

409Cmostly conserved

427Tmostly conserved

433Tmostly conserved

481Amostly conserved

505Cmostly conserved

550Amostly conserved

559Tmostly conserved

562Amostly conserved

568Cmostly conserved

607Amostly conserved

613Tmostly conserved

622Gmostly conserved

625Amostly conserved

646Tmostly conserved

AATATTATACTTTATTTTCGCAATATGGGCTGGTATAATTGGAGCCTCATTAAGATTCATTATTCGTATAGAACTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena chrysoscelessame genus4.4%Andrena curvanasame genus4.6%Andrena griseobalteatasame genus9.6%Andrena pandelleisame genus11.1%Andrena haemorrhoasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 526 records

Wild obs. + sensor402

Museum / vouchered1 036

Other88

Origin

Native284

Range

Area of Occupancy AOO2 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 70≤1 km 54≤10 km 268

392 georeferenced · 10 without coordinates

Open the mapobservation + sensor402

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 7≤1 km 402≤10 km 524>10 km 32

965 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence1 036

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	415
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	96
Zürich, CH	76
Paro, BT	54
Geneva, CH	45
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	33
Bern, CH	23
Musee d'Histoire Naturallelocation not on record	18
ZSMlocation not on record	16
Bavarian State Collection of Zoologylocation not on record	15
NMOKlocation not on record	15
PRUNlocation not on record	13
Bonn, DE	11
Museum zu Allerheiligen Schaffhausenlocation not on record	8
Cambridge, US	8
Dhaka, BD	8
PRAZlocation not on record	6
Natuurpuntlocation not on record	6
Wuzhou, CN	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
MNHWlocation not on record	4
Champaign, US	4
Philadelphia, US	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Coimbra, PT	2
Natural History Museum Rotterdamlocation not on record	2
Natural History Museum, Londonlocation not on record	1
Mons, BE	1
ULglocation not on record	1
UMUlocation not on record	1
Mykotektet, National Veterinary Institutelocation not on record	1

31 institutions · 896 of 1 036 vouchered records shown · 140 without an institution code

09Environmental DNA26 detections

Where the DNA of Andrena nitidiuscula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map8 countries0

copper ore tailings pond

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 11.8–19.6

Seasonal swing summer↔winter18.3 °C

Max temp (day)22.7 °C 15.5–25.2

Min temp (night)13.0 °C 6.80–14.7

Precipitation67.7 mm/mo 21.5–123

Air humidity57.4 % 51.4–61.1

Moisture balance-43.6 mm/mo -153–11.7

Vapour deficit902 Pa 569–1,112

Wind speed3.10 m/s 2.40–3.90

Cloud cover34.3 % 23.7–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena nitidiuscula

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 526 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 526 records