Andrena cerasifolii

Cockerell, 1896 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 922

Data sources9

Biological traits1

DNA specimens18

eDNA detections27

Sources9 archives

Databases and archives Andrena cerasifolii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 922 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 922 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT · NCBI≈370 Mbp

01Narrative

The cherry leaf miner bee (Andrena cerasifolii) is a species of miner bee in the family Andrenidae. Another common name for this species is cherry plum miner. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.65 mm

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena cerasifolii has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections27

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

54Gmostly conserved

74Tvariable

88Tmostly conserved

102Amostly conserved

133Tmostly conserved

136Cvariable

163Gvariable

265Amostly conserved

271Tmostly conserved

289Tvariable

388Amostly conserved

439Tmostly conserved

499Amostly conserved

517Amostly conserved

523Tmostly conserved

539Cvariable

631Tmostly conserved

AATACTATATTTTATTTTCGCAATATGAGCAGGTATAATTGGTGCATCACTAAGATTTATTATCCGTATAGAATTAAGAAATCCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes5

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena amphibolasame genus10.3%Andrena cupreotinctasame genus10.6%Andrena cyanophilasame genus11.2%Andrena haemorrhoasame genus11.3%Andrena limatasame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Andrena cerasifolii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈369 980 408 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena cerasifolii0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 922 records

Wild obs. + sensor273

Museum / vouchered1 642

Other7

Origin

Native3

Range

Area of Occupancy AOO2 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 146≤1 km 44≤10 km 12>10 km 20

222 georeferenced · 51 without coordinates

Open the mapobservation + sensor273

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 40≤1 km 28≤10 km 391>10 km 12

471 georeferenced · 1 171 without coordinates

Open the institutions mapphysical evidence1 642

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	776
Champaign, US	303
Wuzhou, CN	144
	137
University of Alabamalocation not on record	94
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	50
La Jolla, US	25
OSUClocation not on record	13
Essig Museum of Entomologylocation not on record	13
San Diego, US	12
Cambridge, US	10
UNHClocation not on record	9
Colorado State Universitylocation not on record	7
WSUClocation not on record	6
Santa Cruz, US	5
Santa Barbara Museum of Natural Historylocation not on record	4
Albuquerque, US	3
Los Angeles, US	3
Provo, US	2
New Haven, US	2
Budapest, HU	2
ASUlocation not on record	2
Royal Saskatchewan Museumlocation not on record	1
Mexico City, MX	1
Washington, US	1
EL PASO, US	1
San Francisco, US	1
University of Central Floridalocation not on record	1

28 institutions · 1 628 of 1 642 vouchered records shown · 14 without an institution code

09Environmental DNA27 detections

Where the DNA of Andrena cerasifolii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

Uplandfreshwater stream, and mediterranean climate…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 8.00–23.0

Seasonal swing summer↔winter17.9 °C

Max temp (day)19.8 °C 13.9–30.5

Min temp (night)7.30 °C 1.40–15.9

Precipitation20.6 mm/mo 5.80–60.6

Air humidity53.0 % 39.0–60.2

Moisture balance-111 mm/mo -173–-40.0

Vapour deficit695 Pa 507–1,729

Wind speed2.50 m/s 1.60–3.60

Cloud cover31.3 % 15.1–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena cerasifolii

At a glance

Sources9 archives

Size & morphology1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 922 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 922 records