Andrena berberidis — The Life Data

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records22

Data sources6

Biological traits1

DNA specimens11

eDNA detections0

Sources6 archives

Databases and archives Andrena berberidis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF22 records

DNA & barcodingBOLD11 specimens

01Narrative

The barberry miner bee (Andrena berberidis) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.45 mm

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena berberidis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes1

BINs2

Where individuals differ — all 7 variable positions, in barcode order

197Cmostly conserved

295Gmostly conserved

304Tmostly conserved

427Tmostly conserved

479Tmostly conserved

565Gmostly conserved

613Tmostly conserved

AATACTATATTTTATATTCGCTATATGAGCAGGAATAATTGGAGCATCACTAAGATTTATCATCCGAATAGAATTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena acceptasame genus10.3%Andrena haemorrhoasame genus10.4%Andrena mocsaryisame genus10.6%Andrena angustiorsame genus11.1%Andrena birtwellisame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type22 records

Museum / vouchered22

Range

Area of Occupancy AOO60 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 1≤10 km 10

11 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence22

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	7
	4
Champaign, US	4
Colorado State Universitylocation not on record	3
Cambridge, US	2
Philadelphia, US	1
WSUClocation not on record	1

7 institutions · 22 of 22 vouchered records shown