Andrena accepta

Viereck, 1916 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records766

Data sources7

Biological traits0

DNA specimens7

eDNA detections9

Sources7 archives

Databases and archives Andrena accepta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility766 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF766 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD7 specimens

01Narrative

The two-spotted miner bee (Andrena accepta) is a species of miner bee in the family Andrenidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena accepta has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.86%

Haplotypes1

BIN1

Where individuals differ — all 13 variable positions, in barcode order

10Cvariable

19Cmostly conserved

20Gmostly conserved

21Cvariable

22Avariable

34Amostly conserved

263Cmostly conserved

316Amostly conserved

388Amostly conserved

581Cvariable

609Tmostly conserved

610Cmostly conserved

628Cvariable

AATATTATACTTTATATTCGCAATATGAGCAGGAATGATTGGTGCATCACTAAGATTCATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena birtwellisame genus9.9%Andrena mocsaryisame genus10.6%Andrena nivalissame genus10.6%Andrena clarkellasame genus11.0%Andrena florivagasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type766 records

Wild obs. + sensor63

Museum / vouchered703

Range

Area of Occupancy AOO884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 34≤1 km 10≤10 km 1>10 km 14

59 georeferenced · 4 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 11≤1 km 28≤10 km 151>10 km 44

234 georeferenced · 469 without coordinates

Open the institutions mapphysical evidence703

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	224
Wuzhou, CN	192
Champaign, US	137
Beltsville, US	43
WIlocation not on record	39
Universidad Católica de Manizaleslocation not on record	25
Albuquerque, US	11
Cambridge, US	9
US	5
OSUClocation not on record	5
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
Mississippi State, US	3
Ciudad de México, MX	2
Colorado State Universitylocation not on record	1
Blacksburg, US	1
MNDNRlocation not on record	1
University of Alabamalocation not on record	1

17 institutions · 703 of 703 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Andrena accepta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 14.4–23.2

Seasonal swing summer↔winter19.1 °C

Max temp (day)26.1 °C 20.8–29.2

Min temp (night)13.6 °C 7.80–17.7

Precipitation43.3 mm/mo 12.5–88.3

Air humidity47.0 % 43.2–52.4

Moisture balance-77.2 mm/mo -97.1–-73.3

Vapour deficit1,207 Pa 1,065–1,361

Wind speed2.40 m/s 2.40–3.10

Cloud cover22.4 % 17.9–30.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)