Andrena angustior

(Kirby, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 218

Data sources9

Biological traits1

DNA specimens43

eDNA detections38

Sources9 archives

Databases and archives Andrena angustior's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 218 records

Environmental DNA1 datasets · 6 countries38 detections

DNA & barcodingBOLD43 specimens

Genome at a glanceGoaT · NCBI≈326 Mbp

01Narrative

Andrena angustior is a Palearctic species of mining bee.BWARSEdward Saunders 1896, The Hymenoptera Aculeata of the British Isles London. pdf us.archive Full text with illustrations]

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.73 mm

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena angustior has left across the world's sequence archives.

At a glance

DNA specimens43

BINs2

Marker genes1

eDNA detections38

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Cmostly conserved

16Tmostly conserved

89Amostly conserved

142Tmostly conserved

160Gvariable

214Gmostly conserved

250Tmostly conserved

271Tmostly conserved

290Tmostly conserved

304Gvariable

331Amostly conserved

337Amostly conserved

415Cmostly conserved

418Cmostly conserved

496Tmostly conserved

578Tmostly conserved

613Tmostly conserved

CATACTATATTTTATTTTCGCTATATGAGCAGGAATAATTGGTGCATCACTTAGATTTATTATTCGTATAGAATTAAGAAATCCAGGCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes9

BINs2

Most divergent pair1.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena fulvatasame genus3.5%Andrena igraecasame genus7.0%Andrena montanasame genus8.2%Andrena impressasame genus8.4%Andrena rufitibialissame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Andrena angustior carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈326 358 822 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena angustior0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.1% BUSCO

08Occurrence & distribution

Record type2 218 records

Wild obs. + sensor799

Museum / vouchered1 280

Other139

Origin

Native3

Range

Area of Occupancy AOO2 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 192≤1 km 83≤10 km 446

721 georeferenced · 78 without coordinates

Open the mapobservation + sensor799

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 7≤1 km 247≤10 km 759>10 km 1

1 014 georeferenced · 266 without coordinates

Open the institutions mapphysical evidence1 280

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ULglocation not on record	393
Mons, BE	221
Natuurpuntlocation not on record	70
Natural History Museum Rotterdamlocation not on record	52
Muzeum Górnośląskie w Bytomiulocation not on record	42
Bonn, DE	18
NMOKlocation not on record	18
Wuzhou, CN	16
NCMGlocation not on record	14
South Kensington, GB	13
Ghent, BE	6
Tilburg, NL	6
ZSMlocation not on record	5
Bavarian State Collection of Zoologylocation not on record	4
Provincia di Livornolocation not on record	4
Nijmegen, NL	3
Coimbra, PT	3
CBDClocation not on record	3
MNHWlocation not on record	3
Beltsville, US	2
Cambridge, US	1
IMEDEAlocation not on record	1
Namur, BE	1
Ugentlocation not on record	1

24 institutions · 900 of 1 280 vouchered records shown · 380 without an institution code

09Environmental DNA38 detections

Where the DNA of Andrena angustior was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map6 countries0

kiwifruit orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 9.00–13.9

Seasonal swing summer↔winter12.2 °C

Max temp (day)14.7 °C 13.0–18.1

Min temp (night)8.30 °C 4.00–8.90

Precipitation80.7 mm/mo 64.1–136

Air humidity61.2 % 59.6–62.6

Moisture balance35.2 mm/mo

Vapour deficit540 Pa 430–609

Wind speed3.70 m/s

Cloud cover45.8 % 36.8–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena angustior

At a glance

Sources9 archives

Size & morphology1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 218 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 218 records