Andrena fulvata

E.Stöckhert, 1930 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records4 872

Data sources7

Biological traits3

DNA specimens25

eDNA detections16

Sources7 archives

Databases and archives Andrena fulvata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 872 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF4 872 records

Environmental DNA1 datasets · 3 countries16 detections

DNA & barcodingBOLD25 specimens

01Narrative

De kleine zandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1930 door Stoeckhert.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Intertegular distance (ITD)1.97 mm

Tongue length2 mm

Tongue width0.3 mm

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena fulvata has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes2

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes1

BIN1

Where individuals differ — all 10 variable positions, in barcode order

142Tvariable

197Cmostly conserved

199Cmostly conserved

201Cmostly conserved

203Cmostly conserved

316Gmostly conserved

367Tmostly conserved

403Amostly conserved

538Amostly conserved

631Gvariable

CATGCTATATTTTATTTTCGCTATATGAGCAGGAATAATTGGTGCATCACTTAGATTCATTATTCGTATAGAATTAAGAAATCCAGGCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena angustiorsame genus3.5%Andrena igraecasame genus7.9%Andrena impressasame genus8.0%Andrena vulpeculasame genus9.1%Andrena montanasame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type4 872 records

Wild obs. + sensor2 806

Museum / vouchered2 061

Other5

Origin

Native1 978

Range

Area of Occupancy AOO2 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 28≤1 km 9≤10 km 2 692>10 km 1

2 730 georeferenced · 76 without coordinates

Open the mapobservation + sensor2 806

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 6≤1 km 274≤10 km 1 572>10 km 84

1 936 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence2 061

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	276
Zürich, CH	208
Bern, CH	162
Musee d'Histoire Naturallelocation not on record	161
Paro, BT	149
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	93
Bonn, DE	74
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	66
PRAZlocation not on record	42
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	37
Fribourg, CH	31
Museum zu Allerheiligen Schaffhausenlocation not on record	25
Geneva, CH	22
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	18
ZSMlocation not on record	15
Universität Zürich, Naturhistorisches Museumlocation not on record	12
PRUNlocation not on record	10
AGClocation not on record	8
Naturmuseum Oltenlocation not on record	6
ARTlocation not on record	6
Bavarian State Collection of Zoologylocation not on record	4
NMOKlocation not on record	4
	3
Naturmuseum Solothurnlocation not on record	2
Wuzhou, CN	2
Dhaka, BD	2
IZNElocation not on record	2
Champaign, US	2
Research Collection of Christophe Prazlocation not on record	1
University of Florence, Department of Biologylocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1

31 institutions · 1 445 of 2 061 vouchered records shown · 616 without an institution code

09Environmental DNA16 detections

Where the DNA of Andrena fulvata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map3 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 8.60–14.0

Seasonal swing summer↔winter18.6 °C

Max temp (day)13.7 °C 13.1–18.0

Min temp (night)4.10 °C 3.00–8.50

Precipitation70.8 mm/mo 56.8–111

Air humidity58.9 % 58.3–59.9

Moisture balance-12.9 mm/mo -27.8–1.50

Vapour deficit497 Pa 461–654

Wind speed3.10 m/s 2.20–3.50

Cloud cover38.6 % 36.2–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena fulvata

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type4 872 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 872 records