Andrena algida

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records470

Data sources7

Biological traits1

DNA specimens19

eDNA detections18

Sources7 archives

Databases and archives Andrena algida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF470 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD19 specimens

01Narrative

The icy miner bee (Andrena algida) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.21 mm

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena algida has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

49Cmostly conserved

160Gvariable

163Avariable

178Tmostly conserved

364Cmostly conserved

376Cmostly conserved

448Cmostly conserved

481Tmostly conserved

523Cmostly conserved

544Cmostly conserved

548Tmostly conserved

559Gvariable

578Tmostly conserved

595Tmostly conserved

634Tmostly conserved

AATATTATATTTTATTTTTGCAATATGAGCAGGAATAATTGGAGCATCCCTTAGATTTATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes4

BINs2

Most divergent pair2.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena ruficrussame genus2.5%Andrena fulvidasame genus7.9%Andrena caeruleasame genus8.1%Andrena tridenssame genus9.0%Andrena lawrenceisame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type470 records

Wild obs. + sensor1

Museum / vouchered469

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 79≤1 km 30≤10 km 70>10 km 13

192 georeferenced · 277 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	106
WIlocation not on record	99
	62
Beltsville, US	46
Cornell University Insect Collectionlocation not on record	36
Champaign, US	33
Cambridge, US	20
East Lansing, US	10
Anchorage, US	9
Colorado State Universitylocation not on record	8
Vancouver, CA	6
UNHClocation not on record	4
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
White River Junction, US	4
Universidad Católica de Manizaleslocation not on record	3
New Haven, US	3
Toronto, CA	2
Awka, NG	2
Centre for Biodiversity Genomicslocation not on record	1
UTSClocation not on record	1
Saint John, CA	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
Essig Museum of Entomologylocation not on record	1
LULlocation not on record	1

25 institutions · 464 of 469 vouchered records shown · 5 without an institution code

09Environmental DNA18 detections

Where the DNA of Andrena algida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

GrasslandAgricultural fieldwoodlandSalix sp.Village, Park. Grass/Sedge; Taraxacum sp., A…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 7.50–14.4

Seasonal swing summer↔winter29.9 °C

Max temp (day)15.6 °C 12.1–19.2

Min temp (night)6.80 °C 1.90–9.30

Precipitation80.8 mm/mo 47.5–94.9

Air humidity55.9 % 53.6–62.9

Moisture balance-39.6 mm/mo -63.5–10.2

Vapour deficit562 Pa 455–737

Wind speed2.80 m/s 1.70–4.30

Cloud cover44.7 % 40.8–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)