Andrena fulvida

Schenck, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 016

Data sources6

Biological traits2

DNA specimens13

eDNA detections14

Sources6 archives

Databases and archives Andrena fulvida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 016 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 016 records

Environmental DNA1 datasets · 6 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

De sporkehoutzandbij' is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Schenck.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)2.27 mm

Tongue length2.06 mm

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena fulvida has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections14

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

100Tmostly conserved

121Amostly conserved

122Amostly conserved

199Tmostly conserved

226Cmostly conserved

280Cmostly conserved

337Amostly conserved

343Tmostly conserved

385Tmostly conserved

400Amostly conserved

406Cmostly conserved

415Cmostly conserved

424Amostly conserved

427Cmostly conserved

445Tmostly conserved

457Cmostly conserved

475Tmostly conserved

502Gmostly conserved

544Cmostly conserved

568Cmostly conserved

592Tmostly conserved

595Tmostly conserved

596Cmostly conserved

598Amostly conserved

601Cmostly conserved

610Cmostly conserved

643Gmostly conserved

AATATTATATTTTATTTTTGCAATATGAGCAGGAATAATTGGAGCATCACTTAGATTTATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes3

BINs2

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena ruficrussame genus7.3%Andrena algidasame genus7.9%Andrena geraniisame genus8.5%Andrena igraecasame genus8.8%Andrena nigrihirtasame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 016 records

Wild obs. + sensor305

Museum / vouchered708

Other3

Origin

Native45

Range

Area of Occupancy AOO2 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 174≤1 km 56≤10 km 75

305 georeferenced

Open the mapobservation + sensor305

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 166≤1 km 195≤10 km 224>10 km 7

592 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence708

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	269
SLU Artdatabankenlocation not on record	97
Philadelphia, US	49
Bonn, DE	25
Provincia di Livornolocation not on record	25
Wuzhou, CN	22
NMBU:MINAlocation not on record	17
Paro, BT	17
ULglocation not on record	14
Muzeum Górnośląskie w Bytomiulocation not on record	13
NMOKlocation not on record	9
KZMlocation not on record	6
Musee d'Histoire Naturallelocation not on record	6
Bern, CH	5
Natural History Museum Rotterdamlocation not on record	5
ZSMlocation not on record	4
Trondheim, NO	4
PRUNlocation not on record	4
PRAZlocation not on record	4
AGClocation not on record	4
NHMOlocation not on record	4
Fribourg, CH	4
Ugentlocation not on record	2
Zürich, CH	2
BioFokuslocation not on record	2
Mons, BE	2
Ghent, BE	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Tilburg, NL	2
MNHWlocation not on record	1
	1
Metsähallituslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Stockholm, SE	1
Natuurpuntlocation not on record	1

35 institutions · 627 of 708 vouchered records shown · 81 without an institution code

09Environmental DNA14 detections

Where the DNA of Andrena fulvida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 14.0–17.3

Seasonal swing summer↔winter18.8 °C

Max temp (day)19.9 °C 18.2–21.3

Min temp (night)11.0 °C 8.70–13.6

Precipitation92.8 mm/mo 62.8–143

Air humidity59.0 % 58.0–60.2

Moisture balance-22.9 mm/mo -51.0–20.5

Vapour deficit729 Pa 670–810

Wind speed3.40 m/s 2.40–4.00

Cloud cover38.6 % 33.7–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena fulvida

At a glance

Sources6 archives

Size & morphology2

At a glance

Record type1 016 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 016 records