Ancylis selenana

(Guenée, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records453

Data sources8

Biological traits0

DNA specimens22

eDNA detections22

Sources8 archives

Databases and archives Ancylis selenana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF453 records

Environmental DNA1 datasets · 4 countries22 detections

DNA & barcodingBOLD22 specimens

01Narrative

Ancylis selenana is a moth of the family Tortricidae. It is found from southern Sweden and Finland to France and Italy and to the Balkan Peninsula. Outside of Europe, it is found from Asia Minor to southern Siberia and Korea. The wingspan is 10–15 mm. Adults are on wing from April to May and again in July and August in Germany and Poland. There are two generations per year in Germany and Poland. In southern Europe, there can be up to five generations yearly. The larvae feed on Crataegus, Prunus cerasus vulgaris, Prunus avium, Prunus virginiana, Prunus spinosa, Prunus domestica, Prunus armeniaca, Malus and Pyrus. The larvae damage the leaves of the host plant. The species can cause serious damage to young trees, but has not been reported from orchards often.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis selenana has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections22

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

26Cmostly conserved

191Tmostly conserved

269Cvariable

485Tvariable

CCTCTTTAAGATTACTAATTCGAGCCGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTACAATACTATTGTAACCGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes5

BIN1

Most divergent pair0.49%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis obtusanasame genus8.3%Argyrotaenia coconinanasame family8.8%Ancylis apicanasame genus8.9%Platynota semiustanasame family9.4%Ancylis apicellasame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type453 records

Wild obs. + sensor326

Museum / vouchered115

Other12

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 107≤1 km 65≤10 km 55>10 km 5

232 georeferenced · 94 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 16≤1 km 41≤10 km 15

72 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	19
Tartu, EE	11
Kuopio, FI	11
SLU Artdatabankenlocation not on record	11
National Institute of Biological Resourceslocation not on record	10
Chiba, JP	9
Provincia di Livornolocation not on record	8
Stockholm, SE	7
KIRMlocation not on record	1
Iwate Prefectural Museumlocation not on record	1
KOMlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1

13 institutions · 91 of 115 vouchered records shown · 24 without an institution code

09Environmental DNA22 detections

Where the DNA of Ancylis selenana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 14.2–25.2

Seasonal swing summer↔winter21.3 °C

Max temp (day)26.5 °C 17.1–26.5

Min temp (night)23.8 °C 9.20–23.8

Precipitation218 mm/mo 68.2–218

Air humidity69.1 % 57.9–69.1

Moisture balance58.3 mm/mo -43.9–58.3

Vapour deficit989 Pa 688–989

Wind speed4.20 m/s 3.10–4.20

Cloud cover42.0 % 33.8–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)