Ancylis apicana

(Walker, 1866) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records138

Data sources7

Biological traits0

DNA specimens39

eDNA detections39

Sources7 archives

Databases and archives Ancylis apicana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility138 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF138 records

Environmental DNA1 datasets · 2 countries39 detections

DNA & barcodingBOLD39 specimens

01Narrative

Ancylis apicana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is, als Grapholita apicana, voor het eerst geldig gepubliceerd in 1866 door Francis Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis apicana has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes1

eDNA detections39

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

307Gvariable

376Amostly conserved

607Tmostly conserved

619Tmostly conserved

622Amostly conserved

628Amostly conserved

640Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes3

BINs2

Most divergent pair2.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis muricanasame genus2.8%Ancylis mitterbacherianasame genus5.8%Ancylis laetanasame genus7.3%Episimus tyriussame family7.7%Ancylis pacificanasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type138 records

Wild obs. + sensor62

Museum / vouchered76

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 42≤1 km 4≤10 km 2>10 km 6

54 georeferenced · 8 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 76 records without

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
University of Alberta Museums (UAM)location not on record	20
St. Paul, US	5
Research Collection of Daniel Handfieldlocation not on record	2

4 institutions · 47 of 76 vouchered records shown · 29 without an institution code

09Environmental DNA39 detections

Where the DNA of Ancylis apicana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 13.9–17.9

Seasonal swing summer↔winter28.2 °C

Max temp (day)20.6 °C 18.1–22.9

Min temp (night)12.5 °C 9.60–15.1

Precipitation105 mm/mo 80.3–126

Air humidity59.5 % 55.6–64.8

Moisture balance-27.1 mm/mo -48.1–9.50

Vapour deficit692 Pa 644–836

Wind speed2.40 m/s 2.20–3.50

Cloud cover44.8 % 36.3–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)