Ancylis muricana

(Walsingham, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records313

Data sources7

Biological traits0

DNA specimens20

eDNA detections22

Sources7 archives

Databases and archives Ancylis muricana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility313 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF313 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD20 specimens

01Narrative

Ancylis muricana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1879 door Walsingham.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis muricana has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

49Avariable

50Tmostly conserved

59Tmostly conserved

61Avariable

88Tmostly conserved

101Gmostly conserved

106Tmostly conserved

118Cmostly conserved

163Tmostly conserved

238Avariable

274Cmostly conserved

302Amostly conserved

313Tmostly conserved

364Tmostly conserved

385Cmostly conserved

397Tmostly conserved

412Tmostly conserved

433Avariable

445Tmostly conserved

466Avariable

472Tmostly conserved

475Tmostly conserved

478Cmostly conserved

482Tvariable

520Gmostly conserved

574Tmostly conserved

628Amostly conserved

640Tmostly conserved

643Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes7

BINs2

Most divergent pair4.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis divisanasame genus2.7%Ancylis apicanasame genus2.8%Ancylis mitterbacherianasame genus6.1%Ancylis laetanasame genus7.3%Ancylis pacificanasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type313 records

Wild obs. + sensor261

Museum / vouchered52

Range

Area of Occupancy AOO936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 134≤1 km 64≤10 km 14>10 km 14

226 georeferenced · 35 without coordinates

Open the mapobservation + sensor261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 3≤1 km 1≤10 km 3>10 km 11

18 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	21
East Lansing, US	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Biodiversity Institute of Ontariolocation not on record	1
Philadelphia, US	1
St. Paul, US	1

6 institutions · 43 of 52 vouchered records shown · 9 without an institution code

09Environmental DNA22 detections

Where the DNA of Ancylis muricana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Temperate mixed forestForestUrban14. Artificial - Terrestrial|14.5 Urban AreasMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.4–26.2

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.9 °C 16.4–31.4

Min temp (night)12.4 °C 8.00–22.2

Precipitation95.6 mm/mo 80.1–109

Air humidity58.5 % 54.6–61.5

Moisture balance-30.6 mm/mo -99.4–-9.10

Vapour deficit681 Pa 641–1,430

Wind speed2.90 m/s 2.50–4.50

Cloud cover45.1 % 29.5–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)