Ancylis divisana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records1 364

Data sources8

Biological traits0

DNA specimens52

eDNA detections58

Sources8 archives

Databases and archives Ancylis divisana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 364 records

Environmental DNA1 datasets · 2 countries58 detections

DNA & barcodingBOLD52 specimens

01Narrative

Ancylis divisana, the two-toned ancylis moth, is a moth of the family Tortricidae. It is found in North America, where it has been recorded from Alabama, Colorado, Florida, Georgia, Illinois, Kentucky, Maine, Maryland, Massachusetts, Michigan, Mississippi, North Carolina, Ohio, Oklahoma, Ontario, Pennsylvania, Quebec, South Carolina, Tennessee, Texas and West Virginia.mothphotographersgroup The wingspan is 10–13 mm. Adults have been recorded on wing from March to October. The larvae feed on Carpinus species, Castanea dentata, Quercus species and Platanus species (including Platanus occidentalis).Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis divisana has left across the world's sequence archives.

At a glance

DNA specimens52

BINs2

Marker genes1

eDNA detections58

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

19Tvariable

64Tvariable

88Cvariable

97Tvariable

106Tvariable

115Tvariable

133Tvariable

136Cvariable

169Cvariable

202Avariable

302Amostly conserved

313Cvariable

361Cvariable

367Tvariable

376Cmostly conserved

385Cvariable

386Cvariable

397Tvariable

418Cvariable

427Cvariable

445Tvariable

463Cvariable

472Tvariable

508Tvariable

544Cvariable

565Cvariable

625Amostly conserved

628Avariable

640Tvariable

641Cvariable

646Cvariable

652Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes15

BINs2

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis muricanasame genus2.7%Ancylis mitterbacherianasame genus6.1%Episimus tyriussame family8.1%Ancylis obtusanasame genus8.2%Ancylis pacificanasame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 364 records

Wild obs. + sensor1 200

Museum / vouchered164

Range

Area of Occupancy AOO2 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 639≤1 km 242≤10 km 58>10 km 77

1 016 georeferenced · 184 without coordinates

Open the mapobservation + sensor1 200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 17≤1 km 7≤10 km 21>10 km 4

49 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	100
North Carolina State University Insect Museumlocation not on record	18
East Lansing, US	10
Philadelphia, US	6
St. Paul, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Research Collection of Daniel Handfieldlocation not on record	2
New Haven, US	1
San Francisco, US	1
CUlocation not on record	1
SOVTlocation not on record	1

11 institutions · 148 of 164 vouchered records shown · 16 without an institution code

09Environmental DNA58 detections

Where the DNA of Ancylis divisana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 12.6–26.1

Seasonal swing summer↔winter26.8 °C

Max temp (day)23.0 °C 17.8–31.4

Min temp (night)13.6 °C 7.20–22.2

Precipitation110 mm/mo 71.7–182

Air humidity58.8 % 56.6–62.5

Moisture balance-33.9 mm/mo -64.6–29.6

Vapour deficit856 Pa 583–1,272

Wind speed2.70 m/s 1.90–4.00

Cloud cover39.6 % 29.4–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylis divisana

At a glance

Sources8 archives

At a glance

Record type1 364 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 364 records