Ancylis obtusana

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records2 011

Data sources8

Biological traits2

DNA specimens26

eDNA detections35

Sources8 archives

Databases and archives Ancylis obtusana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 011 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 011 records

Environmental DNA2 datasets · 10 countries35 detections

DNA & barcodingBOLD26 specimens

01Narrative

Ancylis obtusana, the small buckthorn roller, is a moth of the family Tortricidae.Biolib

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis obtusana has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections35

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

181Gmostly conserved

622Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGAACTTCTTTAAGTTTAATAATTCGAGCTGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes4

BIN1

Most divergent pair18.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis tenebricasame genus4.6%Ancylis kennelisame genus4.7%Ancylis comptanasame genus5.5%Ancylis laetanasame genus6.7%Ancylis definitivanasame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 011 records

Wild obs. + sensor1 849

Museum / vouchered103

Other59

Origin

Native4

Range

Area of Occupancy AOO3 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 261≤1 km 159≤10 km 1 251>10 km 11

1 682 georeferenced · 167 without coordinates

Open the mapobservation + sensor1 849

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 9≤1 km 56≤10 km 14

79 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	33
Provincia di Livornolocation not on record	21
Tartu, EE	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
Salzburg, AT	3
National Institute of Biological Resourceslocation not on record	2
Research Collection of Theo Gruenewaldlocation not on record	1
SLU Artdatabankenlocation not on record	1
Durban Natural Science Museumlocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
inatura, Dornbirnlocation not on record	1
University of Kaiserslauternlocation not on record	1

12 institutions · 89 of 103 vouchered records shown · 14 without an institution code

09Environmental DNA35 detections

Where the DNA of Ancylis obtusana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys2

Countries10

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map10 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 12.2–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.0 °C 14.4–21.3

Min temp (night)10.8 °C 7.20–12.2

Precipitation67.5 mm/mo 42.2–111

Air humidity60.4 % 58.0–65.0

Moisture balance-42.8 mm/mo -87.0–14.6

Vapour deficit675 Pa 557–809

Wind speed3.20 m/s 2.00–5.30

Cloud cover38.4 % 34.5–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylis obtusana

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type2 011 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 011 records