Ancylis laetana

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records5 257

Data sources10

Biological traits2

DNA specimens26

eDNA detections37

Sources10 archives

Databases and archives Ancylis laetana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 257 records

Environmental DNA3 datasets · 8 countries37 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT · NCBI≈411 Mbp

01Narrative

Ancylis laetana is a moth of the family Tortricidae. It is found in most of Europe, except the Iberian Peninsula, the Balkan Peninsula, Iceland, Ireland and Ukraine.Fauna Europaea Damage The wingspan is 14–18 mm. Adults are on wing from May to June in one generation per year.UKmoths The larvae feed on Populus tremula and occasionally Populus nigra. They feed in a single leaf which is spun pod-like. The larvae can be found under the folded leaf margin or among the spun leaves.BugWood

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis laetana has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections37

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

166Gmostly conserved

AACATTATATTTTATTTTTGGTGTATGAGCTGGAATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis obtusanasame genus6.7%Ancylis kennelisame genus7.1%Ancylis muricanasame genus7.3%Epiblema desertanasame family7.8%Pandemis coniferanasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ancylis laetana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈410 834 036 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ancylis laetana0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type5 257 records

Wild obs. + sensor4 600

Museum / vouchered580

Other77

Origin

Native1

Range

Area of Occupancy AOO9 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 1 614≤1 km 1 016≤10 km 1 654>10 km 16

4 300 georeferenced · 300 without coordinates

Open the mapobservation + sensor4 600

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 192≤1 km 197≤10 km 85>10 km 2

476 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence580

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	159
NHMOlocation not on record	75
Provincia di Livornolocation not on record	73
SLU Artdatabankenlocation not on record	32
Tartu, EE	32
Salzburg, AT	19
Philadelphia, US	17
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	16
Kuopio, FI	12
Stockholm, SE	12
NTNU-VMlocation not on record	8
Durban Natural Science Museumlocation not on record	8
Nijmegen, NL	3
Rovaniemi, FI	3
Zürich, CH	2
NMBU:MINAlocation not on record	2
South Kensington, GB	2
ZMAAlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
ZSMlocation not on record	1
Oulu, FI	1
Tallinn, EE	1
University of Kaiserslauternlocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Helsinki, FI	1
Brussels, BE	1

30 institutions · 489 of 580 vouchered records shown · 91 without an institution code

09Environmental DNA37 detections

Where the DNA of Ancylis laetana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys3

Countries8

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map8 countries0

Floodplain forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 7.40–18.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)18.2 °C 10.2–22.7

Min temp (night)9.40 °C 2.70–13.2

Precipitation75.2 mm/mo 54.5–118

Air humidity58.8 % 56.9–62.6

Moisture balance-27.1 mm/mo -57.5–28.7

Vapour deficit646 Pa 424–871

Wind speed2.70 m/s 2.00–3.70

Cloud cover39.4 % 34.0–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylis laetana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 257 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 257 records