Ancylis apicella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records5 721

Data sources7

Biological traits2

DNA specimens29

eDNA detections40

Sources7 archives

Databases and archives Ancylis apicella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 721 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 721 records

Environmental DNA3 datasets · 12 countries40 detections

DNA & barcodingBOLD29 specimens

01Narrative

Ancylis apicella is a moth of the family Tortricidae. It is found in the Palearctic realm. The wingspan is 12–17 mm. The larvae feed on Frangula alnus, Rhamnus frangula, Ligustrum, Prunus spinosa and Cornus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis apicella has left across the world's sequence archives.

At a glance

DNA specimens29

BINs3

Marker genes1

eDNA detections40

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

40Amostly conserved

154Cvariable

160Amostly conserved

212Tvariable

235Tvariable

355Tvariable

364Cvariable

412Amostly conserved

433Cvariable

508Tmostly conserved

536Tvariable

574Avariable

637Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAACTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.95%

Haplotypes9

BINs3

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis metamelanasame genus4.6%Ancylis maritimasame genus4.9%Ancylis nubeculanasame genus5.2%Ancylis spiraeifolianasame genus5.5%Ancylis mirasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 721 records

Wild obs. + sensor4 838

Museum / vouchered744

Other139

Origin

Native1

Range

Area of Occupancy AOO8 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 1 978≤1 km 1 168≤10 km 1 370>10 km 13

4 529 georeferenced · 309 without coordinates

Open the mapobservation + sensor4 838

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 189≤1 km 289≤10 km 128

606 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence744

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	159
Provincia di Livornolocation not on record	116
Tartu, EE	74
NHMOlocation not on record	72
Kuopio, FI	57
SLU Artdatabankenlocation not on record	34
Nijmegen, NL	33
Salzburg, AT	32
Stockholm, SE	18
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	10
Natural History Museum Rotterdamlocation not on record	8
Philadelphia, US	7
Rovaniemi, FI	6
European Distributed Institute of Taxonomy (EDIT)location not on record	5
University of Kaiserslauternlocation not on record	3
Uniwersytet Łódzkilocation not on record	3
NMBU:MINAlocation not on record	2
Zürich, CH	2
ZMAAlocation not on record	2
Research Collection of Hartmut Wegnerlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
South Kensington, GB	1
neflocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Tallinn, EE	1
NTNU-VMlocation not on record	1
Helsinki, FI	1
Metsähallituslocation not on record	1
Durban Natural Science Museumlocation not on record	1
ZSMlocation not on record	1

31 institutions · 655 of 744 vouchered records shown · 89 without an institution code

09Environmental DNA40 detections

Where the DNA of Ancylis apicella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys3

Countries12

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map12 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 6.40–18.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.2 °C 9.20–22.9

Min temp (night)10.5 °C 2.10–15.6

Precipitation60.1 mm/mo 44.0–127

Air humidity60.3 % 56.8–64.3

Moisture balance-42.9 mm/mo -86.3–46.4

Vapour deficit636 Pa 383–909

Wind speed3.00 m/s 1.90–5.30

Cloud cover39.8 % 33.8–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylis apicella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type5 721 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 721 records