Ancylis metamelana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records667

Data sources7

Biological traits0

DNA specimens131

eDNA detections120

Sources7 archives

Databases and archives Ancylis metamelana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility667 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics131 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF667 records

Environmental DNA1 datasets · 2 countries120 detections

DNA & barcodingBOLD131 specimens

01Narrative

Ancylis angulifasciana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1875 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding131 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis metamelana has left across the world's sequence archives.

At a glance

DNA specimens131

BINs2

Marker genes1

eDNA detections120

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus128 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

22Gvariable

23Amostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

38Gmostly conserved

40Amostly conserved

49Tvariable

50Cmostly conserved

55Amostly conserved

82Cvariable

97Tmostly conserved

127Tmostly conserved

133Tmostly conserved

169Amostly conserved

172Tmostly conserved

205Amostly conserved

206Tmostly conserved

208Amostly conserved

217Amostly conserved

220Cmostly conserved

235Tmostly conserved

241Tmostly conserved

271Cmostly conserved

274Cmostly conserved

302Amostly conserved

313Tmostly conserved

364Tmostly conserved

367Tmostly conserved

370Amostly conserved

397Tmostly conserved

400Tmostly conserved

401Tmostly conserved

406Tmostly conserved

407Tmostly conserved

409Amostly conserved

412Amostly conserved

421Tmostly conserved

433Tmostly conserved

448Tmostly conserved

457Tmostly conserved

469Tmostly conserved

484Tmostly conserved

485Tmostly conserved

493Gvariable

536Tmostly conserved

556Gvariable

557Tmostly conserved

565Gmostly conserved

568Amostly conserved

571Tmostly conserved

580Cmostly conserved

589Tmostly conserved

604Amostly conserved

607Amostly conserved

616Tmostly conserved

628Amostly conserved

634Tmostly conserved

637Tmostly conserved

643Amostly conserved

652Cmostly conserved

AACATTATATTTTATTTTTGGGATTTGAGCTGGAATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes16

BINs2

Most divergent pair8.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis maritimasame genus1.7%Ancylis paludanasame genus4.0%Ancylis badianasame genus4.1%Ancylis habelerisame genus4.1%Ancylis rhenanasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type667 records

Wild obs. + sensor486

Museum / vouchered181

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 325≤1 km 65≤10 km 15>10 km 16

421 georeferenced · 65 without coordinates

Open the mapobservation + sensor486

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 3≤1 km 18≤10 km 23>10 km 11

55 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	43
University of Guelph, Centre for Biodiversity Genomicslocation not on record	32
OSUClocation not on record	17
University of Alberta Museums (UAM)location not on record	14
St. Paul, US	9
Philadelphia, US	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Essig Museum of Entomologylocation not on record	3
New Haven, US	2
San Francisco, US	1
Cornell University Insect Collectionlocation not on record	1
Saint John, CA	1
Royal Saskatchewan Museumlocation not on record	1

13 institutions · 133 of 181 vouchered records shown · 48 without an institution code

09Environmental DNA120 detections

Where the DNA of Ancylis metamelana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found120

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 120 detections have coordinates

Open the map2 countries0

Temperate mixed forestopen pine forestRiparian Zone14. Artificial - Terrestrial|14.1 Arable Landfarm1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 7.70–20.4

Seasonal swing summer↔winter28.5 °C

Max temp (day)19.7 °C 11.2–25.4

Min temp (night)10.0 °C 2.50–16.4

Precipitation81.0 mm/mo 38.3–104

Air humidity57.6 % 54.5–64.1

Moisture balance-48.2 mm/mo -81.1–17.9

Vapour deficit699 Pa 448–989

Wind speed2.70 m/s 1.50–4.50

Cloud cover41.0 % 36.7–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 119 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)