Ancylis paludana

(Barrett, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records559

Data sources8

Biological traits2

DNA specimens11

eDNA detections11

Sources8 archives

Databases and archives Ancylis paludana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility559 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF559 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Ancylis paludana is a butterfly belonging to the family Tortricidae. The species was first described by Charles Golding Barrett in 1871. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis paludana has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

34Gmostly conserved

40Amostly conserved

160Gmostly conserved

263Cmostly conserved

325Amostly conserved

412Amostly conserved

481Amostly conserved

AACATTATATTTTATCTTTGGAATTTGAGCTGGGATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes4

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis badianasame genus2.0%Ancylis rhenanasame genus3.5%Ancylis habelerisame genus3.6%Ancylis maritimasame genus4.0%Ancylis metamelanasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type559 records

Wild obs. + sensor489

Museum / vouchered70

Range

Area of Occupancy AOO468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 370≤1 km 50≤10 km 50>10 km 4

474 georeferenced · 15 without coordinates

Open the mapobservation + sensor489

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 16≤1 km 34≤10 km 10

60 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	15
Metsähallituslocation not on record	14
DanishLepidopterologicalSocietylocation not on record	14
Rovaniemi, FI	7
Iwate Prefectural Museumlocation not on record	6
Nijmegen, NL	1
Provincia di Livornolocation not on record	1
Oulu, FI	1
Kuopio, FI	1
University of Kaiserslauternlocation not on record	1
SLU Artdatabankenlocation not on record	1

11 institutions · 62 of 70 vouchered records shown · 8 without an institution code

09Environmental DNA11 detections

Where the DNA of Ancylis paludana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 8.80–16.6

Seasonal swing summer↔winter23.6 °C

Max temp (day)16.0 °C 10.5–20.8

Min temp (night)8.60 °C 7.20–11.2

Precipitation64.1 mm/mo 45.7–68.3

Air humidity57.2 % 56.4–58.3

Moisture balance-49.3 mm/mo

Vapour deficit647 Pa 470–819

Wind speed3.40 m/s

Cloud cover51.4 % 36.7–57.2

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)