Ancylis nubeculana

(Clemens, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records642

Data sources7

Biological traits0

DNA specimens28

eDNA detections30

Sources7 archives

Databases and archives Ancylis nubeculana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility642 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF642 records

Environmental DNA1 datasets · 2 countries30 detections

DNA & barcodingBOLD28 specimens

01Narrative

Ancylis nubeculana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1860 door Clemens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis nubeculana has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections30

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

19Cmostly conserved

181Tmostly conserved

202Cmostly conserved

205Gvariable

367Cmostly conserved

433Amostly conserved

463Cmostly conserved

485Tmostly conserved

577Gmostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes12

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis spiraeifolianasame genus4.9%Ancylis burgessianasame genus5.0%Ancylis simuloidessame genus5.0%Ancylis paludanasame genus5.0%Ancylis lacinianasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type642 records

Wild obs. + sensor471

Museum / vouchered171

Range

Area of Occupancy AOO1 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 253≤1 km 52≤10 km 14>10 km 25

344 georeferenced · 127 without coordinates

Open the mapobservation + sensor471

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 19≤10 km 62>10 km 20

102 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	47
East Lansing, US	32
New Haven, US	20
St. Paul, US	17
University of Alberta Museums (UAM)location not on record	16
Royal Saskatchewan Museumlocation not on record	11
North Carolina State University Insect Museumlocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Cambridge, US	1
Mississippi State, US	1
Colorado State Universitylocation not on record	1
SOVTlocation not on record	1

13 institutions · 164 of 171 vouchered records shown · 7 without an institution code

09Environmental DNA30 detections

Where the DNA of Ancylis nubeculana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map2 countries0

Temperate mixed forest4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C -4.20–18.8

Seasonal swing summer↔winter30.4 °C

Max temp (day)22.1 °C -0.1–23.7

Min temp (night)12.5 °C -7.80–13.9

Precipitation95.7 mm/mo 71.7–131

Air humidity58.3 % 56.1–62.0

Moisture balance-39.0 mm/mo -64.6–113

Vapour deficit836 Pa 173–922

Wind speed2.90 m/s 2.60–5.10

Cloud cover45.1 % 39.5–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)